![Lonelygirl15 Forum Index](templates/subSilver/images/logo_phpBB.gif) |
Lonelygirl15 Forum to post messages about Bree and Danielbeast
|
View previous topic :: View next topic |
Author |
Message |
deagol Thor's Hammer
![](http://www.collectormania.com/previousguests/thomasrobins.jpg)
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Tue Mar 27, 2007 4:57 am Post subject: |
|
|
I thought about 6 and 12 being the track numbers... but something's odd with those tracks:
Song list in the web page:
1. For Karina
2. You're In Love Again
3. My Sweet Skyline
4. How's It Goin', Wells?
5. The Ship Is Real
6. Sweet Like Worms
7. 6,000,000 Dead Punks Can't Be Wrong.
8. The Little Homie In My Tummy
9. White Amplifier 1956
10. He Kept Painting
11. Same As Always
12. If You Loved Anyone (Mary 2004)
Song list in the lyrics file:
1. For Karina
2. The Ship Is Real
3. Sweet Like Worms
4. He Kept Painting
5. The Little Homie in My Tummy
6. 6,000,000 Dead Punks
7. You’re In Love Again
8. How’s It Going, Wells?
9. Same As Always
10. No Buffalo
11. White Amplifier, 1956
12. My Sweet Skyline
13. If You Loved Anyone (Mary 2004) |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
TOSG Devoted Fan
![](http://img186.imageshack.us/img186/6463/ld100vb1.jpg)
Joined: 14 Sep 2006 Posts: 651
|
Posted: Tue Mar 27, 2007 6:38 am Post subject: |
|
|
Hmmm...
Quote: |
a: the state that I’m in
b: travelers have no one to go home to
c: I’ve had a rough year, but I still smile
d: there may be more trouble in my future than tribbles
|
These seem to reference songs on the album.
a) refers to song #3 ("In the state of Texas, the state that we're in)
b) song #1 ("When I get lost, there's no one to go home to")
c) song #8 (You've had a rough year, I know, I know, but you still smile)
d) is a Star Trek reference, which fits with song #2
Sadly, I've got to run to class and cannot pursue this further until this evening. |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
deagol Thor's Hammer
![](http://www.collectormania.com/previousguests/thomasrobins.jpg)
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Tue Mar 27, 2007 8:15 am Post subject: |
|
|
TOSG wrote: | Hmmm...
Quote: |
a: the state that I’m in
b: travelers have no one to go home to
c: I’ve had a rough year, but I still smile
d: there may be more trouble in my future than tribbles
|
These seem to reference songs on the album.
a) refers to song #3 ("In the state of Texas, the state that we're in)
b) song #1 ("When I get lost, there's no one to go home to")
c) song #8 (You've had a rough year, I know, I know, but you still smile)
d) is a Star Trek reference, which fits with song #2
Sadly, I've got to run to class and cannot pursue this further until this evening. |
a: state (#3 lyrics, #6 page tracks) Sweet Like Worms
b: go home (#1 lyrics, #1 page tracks) For Karina
c: rough year smile (#8 lyrics, #4 page tracks) How’s It Going, Wells?
d: tribbles (#2 lyrics, #5 page tracks) The Ship Is Real
Substituting a b c d for 3 1 8 2 in the shifts:
Code: | 6(-3) 6(-1) 6(-3) 12(-8) 6(-3) 12(-8) 6(-3) 12(-0) 6(-3) 6(-2) 6(-3) 12(-8)
|
Substituting a b c d for 6 1 4 5 in the shifts:
Code: | 6(-6) 6(-1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4) |
|
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
Ziola The Order of Denderah
![](http://i129.photobucket.com/albums/p222/ziolamarie/laff.jpg)
Joined: 17 Oct 2006 Posts: 5774
|
Posted: Tue Mar 27, 2007 8:35 am Post subject: |
|
|
Forgive me for being slow as molasses (Deagol, you should be used to this by now ), but now that we've got the number sequence, is it just a matter of applying it to the DNA sequence that we have? Because perhaps the fact that there are inconsistencies in the numbers (track list vs lyrics list) shows that there are possibly 2 things we need to find? |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
deagol Thor's Hammer
![](http://www.collectormania.com/previousguests/thomasrobins.jpg)
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Tue Mar 27, 2007 8:57 am Post subject: |
|
|
Ziola wrote: | Forgive me for being slow as molasses (Deagol, you should be used to this by now ), but now that we've got the number sequence, is it just a matter of applying it to the DNA sequence that we have? Because perhaps the fact that there are inconsistencies in the numbers (track list vs lyrics list) shows that there are possibly 2 things we need to find? |
The problem is that the numbers given to decode the aminoacids give you out of range letters (those 12's).
The DNA translates into this aminoacid chain:
Isoleucine
Proline
Isoleucine
Isoleucine
Isoleucine
Isoleucine
Isoleucine
Ochre
Isoleucine
Aspartic acid
Isoleucine
Isoleucine
As you can see, none of the 12's fit. |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
Ziola The Order of Denderah
![](http://i129.photobucket.com/albums/p222/ziolamarie/laff.jpg)
Joined: 17 Oct 2006 Posts: 5774
|
Posted: Tue Mar 27, 2007 9:01 am Post subject: |
|
|
I suck at puzzles.
But I was wondering if the number sequence could apply to the still unsolved character sequence from Walters YT page?
After all, isn't that a still unsolved puzzle? |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
deagol Thor's Hammer
![](http://www.collectormania.com/previousguests/thomasrobins.jpg)
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Tue Mar 27, 2007 9:29 am Post subject: |
|
|
Ziola wrote: |
I suck at puzzles.
But I was wondering if the number sequence could apply to the still unsolved character sequence from Walters YT page?
After all, isn't that a still unsolved puzzle? |
Z, although there might be more to it (especially the poem connections), the characters gtinkkwdqtskhjcdlyjmaqoe were used as a vigenere key with the first line of the poem to yield "now they know where to find me"
http://lonelygirl15.com/forum/viewtopic.php?p=280451#280451 |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
Ziola The Order of Denderah
![](http://i129.photobucket.com/albums/p222/ziolamarie/laff.jpg)
Joined: 17 Oct 2006 Posts: 5774
|
Posted: Tue Mar 27, 2007 9:33 am Post subject: |
|
|
*goes back to her HighLights magazine*
I am very good at the hidden pictures page ![Very Happy](images/smiles/icon_biggrin.gif) |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
ignatzmouse Enthusiastic Fan
![](http://i161.photobucket.com/albums/t235/ignatzmouse15/statue.jpg)
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Tue Mar 27, 2007 12:56 pm Post subject: |
|
|
Hoo boy, you turn your back for a few hours, and the TAAG gets kidnapped and Walter does a runner to England!
A couple of points on the video...
a) The cover of the archive says "OPA 117 120 101" -- the numbers are just OPA in octal/ascii.
b) The pub they're meeting in is clearly in the UK (the road markings on the junction before the pub are UK road markings, oh yes and everyone's driving on the left). There's probably enough identifying landmarks to track the pub down if we particularly wanted to.
Oh and there's a puzzle too? Cool! _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
ignatzmouse Enthusiastic Fan
![](http://i161.photobucket.com/albums/t235/ignatzmouse15/statue.jpg)
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Tue Mar 27, 2007 1:11 pm Post subject: |
|
|
deagol wrote: | The problem is that the numbers given to decode the aminoacids give you out of range letters (those 12's). |
Moreover, the only codons with 12 or more letters are:
TTT (Phe/F)Phenylalanine
TTC (Phe/F)Phenylalanine
GAT (Asp/D)Aspartic acid
GAC (Asp/D)Aspartic acid
GAA (Glu/E)Glutamic acid
GAG (Glu/E)Glutamic acid
Note that the sequence:
ATTCCTATCATTATAATCATATAAATTGATATCATA
contains no TTT sequence and only one TTC or CTT sequence, so would need to be reordered for us to be able to use "the usual" coding technique.
Edit: it's DNA, not RNA you foolish mouse! _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Last edited by ignatzmouse on Tue Mar 27, 2007 3:05 pm; edited 1 time in total |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
deagol Thor's Hammer
![](http://www.collectormania.com/previousguests/thomasrobins.jpg)
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Tue Mar 27, 2007 2:30 pm Post subject: |
|
|
I tried dividing those numbers by 6.
Code: | 1(-3) 1(-1) 1(-3) 2(-8) 1(-3) 2(-8) 1(-3) 2(-0) 1(-3) 1(-2) 1(-3) 2(-8)
Isoleucine_Proline_Isoleucine_Isoleucine_Isoleucine...Aspartic_acid_Isoleucine_Isoleucine
1 1 1 2 1 ...1 1 2
IPISISICIAIS
fOfKfKfCfYfK (shifts)
|
So I decided to get rid of all those f's, because what remained reminded me of IKYOIYK
Code: | OKKCYK
117 113 113 103 131 113 (octal ascii)
aag aac aac atc aca aac (a=1, c=3, g=7, t=0!)
K N N I T N (amino chain)
Lysine_Asparagine_Asparagine_Isoleucine_Tyrosine_Asparagine
1 1 1 2 1 2
LAASTS
IZXKRK (shifts)
|
It looked promising at one point... unless the word is Laasts ![Rolling Eyes](images/smiles/icon_rolleyes.gif)
Last edited by deagol on Tue Mar 27, 2007 2:36 pm; edited 2 times in total |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
chershaytoute Moderator
![](http://i162.photobucket.com/albums/t269/chershaytoute/gluesticklighthouse.jpg)
Joined: 16 Jan 2007 Posts: 1877 Location: Oregon with an ocean view...across the neighbors' cow pasture, wow!
|
Posted: Tue Mar 27, 2007 2:32 pm Post subject: |
|
|
I do think Z is on to something though - with the fact that the songs are in two lists like that, wouldn't that second set of numbers have a significance...somewhere/how?
(Z, if you pass the HighLights...I have crayons!) _________________ Diane, or cher, or even chershaytoute, but "Hey, you!" works, too...
WWggD - let's make the Breeniverse a better place to live...
Thanks to giddeanx for the coolest personal glue stick ever! |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
Musique Casual Observer
![](http://i167.photobucket.com/albums/u157/Musique36/navesinklightavatar4.jpg)
Joined: 22 Mar 2007 Posts: 68
|
Posted: Tue Mar 27, 2007 2:35 pm Post subject: |
|
|
Oh lord. Walter's a Trekkie now, huh?
I was never great at code breaking, but here's some of my thoughts:
I still say it sounds like he's pining for someone.
With all of this talk about him being on the move, I wonder if his next stop is Texas, or if we should be looking for something in that state. Star Trek... space... Texas... labs... maybe NASA in Houston?
Homie in my tummy references a baby. Could it be a child Walter had with someone, perhaps... unplanned? A child like, say... the baby we see in one of his vids, with the bowed leg bones.
Or, could be a brainchild of his, such as this "Cure", or any other kind of Frankenstein-esque experimentation he has yet to tell us about.
Quote: | Roll call!
12AX7 – yup, yup.
6V6GT – uh, huh.
5Y3GT – boy you know it. |
Am I seeing an encoded message?
Plus, looking at the song lists Deagol posted earlier, what about taking the first letter from each song? Does that formulate a code? I recall Bree did this when trying to communicate with her father in an earlier vid (the one with the titles of the books she had read).
I know... wild assumptions that probably aren't even relative to all of this.
Sad though. Guess I won't be trekking out to Princeton anytime soon.
Unless Walter plans on relaxing on the Jersey Shore. Plenty of former and abandoned "testing facilities" (like Camp Evans, Deal Test Site, and many others) there to indulge in, of which... I'm sure he's aware of.
Musique |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
TOSG Devoted Fan
![](http://img186.imageshack.us/img186/6463/ld100vb1.jpg)
Joined: 14 Sep 2006 Posts: 651
|
Posted: Tue Mar 27, 2007 2:52 pm Post subject: |
|
|
ignatzmouse wrote: | deagol wrote: | The problem is that the numbers given to decode the aminoacids give you out of range letters (those 12's). |
Moreover, the only codons with 12 or more letters are:
UUU (Phe/F)Phenylalanine
UUC (Phe/F)Phenylalanine
GAU (Asp/D)Aspartic acid
GAC (Asp/D)Aspartic acid
GAA (Glu/E)Glutamic acid
GAG (Glu/E)Glutamic acid
Note that the sequence:
ATTCCTATCATTATAATCATATAAATTGATATCATA
contains no Us and only one G, so there is no way that re-ordering the sequence is going to give us anything that matches the three uses of index 12. |
Good analysis, but I should note that "U" in RNA is functionally eqivalent to "T" in DNA. You're looking at a table of RNA codons, but the sequence that we have been given is DNA. |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
ignatzmouse Enthusiastic Fan
![](http://i161.photobucket.com/albums/t235/ignatzmouse15/statue.jpg)
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Tue Mar 27, 2007 2:53 pm Post subject: |
|
|
Musique wrote: | Oh lord. Walter's a Trekkie now, huh? |
I think this puzzle was set by TJ19, since Walter is a bit busy hiding in a disused tube station. _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
![](templates/subSilver/images/spacer.gif) |
|
|
You cannot post new topics in this forum You cannot reply to topics in this forum You cannot edit your posts in this forum You cannot delete your posts in this forum You cannot vote in polls in this forum
|
Powered by phpBB © 2001, 2005 phpBB Group
|