Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

Traveler J - "Catalyst (Find Him)" [02/08/2007]
Goto page Previous  1, 2, 3 ... 9, 10, 11
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Wed Feb 28, 2007 8:48 am    Post subject: Reply with quote

We probably should have made this a separate thread a long time ago, since the title of this one was a previous puzzle that we already solved. Just start a new thread with the summary.
Back to top
View user's profile Send private message Visit poster's website AIM Address
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Wed Feb 28, 2007 9:09 am    Post subject: Reply with quote

McPackage wrote:
We probably should have made this a separate thread a long time ago, since the title of this one was a previous puzzle that we already solved. Just start a new thread with the summary.


Duh Embarassed Great idea McPackage. Done. You can find that new thread here:

http://lonelygirl15.com/forum/viewtopic.php?p=238207#238207

I will move the screen captures over too as soon a I get a chance. I'm pretty sure they are a piece of the puzzle.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Wed Feb 28, 2007 9:42 am    Post subject: Reply with quote

This is from kayokosaeki I asked her to do a frame by frame dissection of the video, and she very graciously accepted. I moved it over from the previous thread where we were working on this so we can keep all the information that has not yet been solved intact.

Below are posted the results she found. Thankyou Kayokosaeki!

Luminous wrote: wrote:


I realize I should give you more specific information, to eliminate any confusion. The video we need analyzed is by user WalterDW on Youtube, and it is called "A Proper Introduction" Here's the link -

http://youtube.com/watch?v=SrU0Im9LjNY

We have discovered there are some marks that look like letters roughly stenciled on a chalkboard. So far we have found several A's and several S's. We need to know exactly how many there are, and if there are any others we have missed. Frame count may also be important.

The other thing we have noticed are some dark grey rectangles that mimic film frames going by. This may or may not be important, but if there is a way to count them, we would like to.

And then of course anything else you see that might be a clue.

Again, thank you so much! I'm excited to see what you find





ok, so there are two frames in which a partial "A" appears superimposed over a 36.





then the 36 shifts to appear twice in one frame....



...before a superimposed "S" appears for two frames



[img]http://farm1.static.flickr.com/135/405287922_8f91a65b53_o.jpg[img]

then don't forget the "GY" which shifts once after 20 frames to be on the right side





then 36 appears again for only 4 frames, just like before only the blacks are darker (i won't post a freeze frame. its just as i say) then 77 appears, shifting once like this



and then 16 frames later the "S" appears again partially



the very end is a fade in and out of the sequence "A" "S" "A" in the same stencil lettering, but i'm going to save my photo bandwidth and not post those freeze frames. its exactly as janesalteredstates posted below

Edit: These are the images were captured from the end of the video by janesalteredstates:







as for the dark grey rectangles that mimic the old film reel, i really see no hidden meaning in them. its just an effect. there's practically one in every frame in the beginning portion (none in the middle or end), but i counted them anyway for you: 47

hope that helps. let me know if you need anything else
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Mon Apr 09, 2007 6:31 pm    Post subject: Reply with quote

Here is a summary of the "Catalyst (Find Him)" puzzle. It's interesting to see the first use of codon/shifting encryption.

The video is at http://www.youtube.com/watch?v=egMFKctGzoE and the description is:
Quote:
If we value the pursuit of knowledge, we must be free to follow wherever that search may lead us.

The tags are:
Quote:
Search 5'3' Restriction FacilityJ OpAphid

The video contains morse code:
Code:
...-- ---.. ---.. ..-. ----. -

which translates to 388F9T which is a tiny url http://tinyurl.com/388F9T resolving to:
Code:
R0dBR1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUd
BVEdHQ0dHQ0NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUN
HQ0dHR0FHVEdBR0dHR0FHQ0FHVFRHR0dDQ0FBR0FUR
0dDR0dDQ0dDQ0dBR0dHQUNDR0dUR0dHQ0dBQ0dHR0
dHQUdUR0FHR0FUQ0NUVFRUVEFUVENUVENHQUNUQ0F
HR0FUQ0NHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0N
HR0NDR0NDR0FHR0dBQ0NHR1RHR0dDR0FDR0dDR0dBR
1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUdBVEdHQ0dHQ0
NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUNHR0dHQUdUR0
FHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0NHR0NDR0N
DR0FHR0dBQ0NHR1RHR0dDR0FDR0NHR0dBR1RHDQoNC
jEoLTQpIDcoLTQpIDggMSAyIDMgOSgtMSkgNCgrMyk=

base64 which converts to
Code:
GGAGTGAGGGGAGCAGTTGGGCCAAGAT
GGCGGCCGCCGAGGGACCGGTGGGCGACGCGG
GAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGC
CGCCGAGGGACCGGTGGGCGACGGGGGAGTGAG
GATCCTTTTTATTCTTCGACTCAGGATCCGGGGAG
CAGTTGGGCCAAGATGGCGGCCGCCGAGGGACC
GGTGGGCGACGGCGGAGTGAGGGGAGCAGTTGG
GCCAAGATGGCGGCCGCCGAGGGACCGGTGGGC
GACGGGGAGTGAGGGGAGCAGTTGGGCCAAGATG
GCGGCCGCCGAGGGACCGGTGGGCGACGCGGGAGTG

1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)

BamHI (a double-cutting restriction enzyme, http://en.wikipedia.org/wiki/Restriction_enzyme) cuts GGATC after the first G, so what is left is:
Code:
GATCCTTTTTATTCTTCGACTCAG

which encodes:
Code:
GAT Aspartic acid
CCT Proline
TTT Phenylalanine
TAT Tyrosine
TCT Serine
TCG Serine
ACT Threonine
CAG Glutamine

which decodes as:
Quote:

1st position: Aspartic Acid. 1st letter: A. 4 letters back in the alphabet (-4): W

2nd position: Proline. 7th letter: E. 4 letters back in the alphabet: A

3rd position: Phenylalanine. 8th letter: L

4th position: Tyrosine. 1st letter: T

5th position: Serine. 2nd letter: E

6th position: Serine. 3rd letter: R

7th position: Threonine. 9th letter: E. 1 letter back in the alphabet: D

8th position: Glutamine. 4th letter: T. 3 letters forward in the alphabet: W

Putting it all together, we get:
Quote:
WALTER DW

which takes us to Walter DW's videos and MySpace. Walter's YouTube profile contains hex which decodes to:
WalterDW wrote:
It looks like the kid has been somewhat successful, even if altogether reckless. I didn’t expect any better of him. Quite frankly I didn’t think that he was competent for this job, but he is all I have. The same goes for you.

Perhaps some background information is in order. I was in charge of production at Facility J. It took us decades and we only produced nineteen of the damned things. You have taken care of two. The problem is that multiple exposures bring increased risk. So neither I nor the youngster nor any one of you can complete the task alone. The kid told me he had some success on the computer, and this is where we are now. Maybe we can work together in the future, assuming you aren’t screw-ups like he is.

_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page Previous  1, 2, 3 ... 9, 10, 11
Page 11 of 11

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP