Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

Facility J [Drop Contents] - "Dei Sub Numine Viget"
Goto page Previous  1, 2, 3 ... 12, 13, 14
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
chershaytoute
Moderator


Joined: 16 Jan 2007
Posts: 1877
Location: Oregon with an ocean view...across the neighbors' cow pasture, wow!

PostPosted: Sat Mar 24, 2007 6:25 pm    Post subject: Reply with quote

Bless you, Z! 'zactly what I was just thinking, obviously!

I'll be Goober to your Dork any day...or am I being Dork to your Goober...or...hmmmm... Think
_________________
Diane, or cher, or even chershaytoute, but "Hey, you!" works, too...

WWggD - let's make the Breeniverse a better place to live...

Thanks to giddeanx for the coolest personal glue stick ever!
Back to top
View user's profile Send private message Send e-mail
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Sat Mar 24, 2007 10:48 pm    Post subject: Reply with quote

Quote:
cure for mankind


I don't think Walter is a man at all. Shocked
_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
chershaytoute
Moderator


Joined: 16 Jan 2007
Posts: 1877
Location: Oregon with an ocean view...across the neighbors' cow pasture, wow!

PostPosted: Sat Mar 24, 2007 11:57 pm    Post subject: Reply with quote

Holy ohmygosh! Now, that would be something... But Traveler J19 referred to Walter has him...so we have a third party reference...?
_________________
Diane, or cher, or even chershaytoute, but "Hey, you!" works, too...

WWggD - let's make the Breeniverse a better place to live...

Thanks to giddeanx for the coolest personal glue stick ever!
Back to top
View user's profile Send private message Send e-mail
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Sun Mar 25, 2007 2:09 pm    Post subject: Reply with quote

Wait.
Holy crap.

OK, "the cure" for XSCID is the X chromosome, if we were talking all poetically or trying to be obtuse. No? Does that make any sense?

I don't even have a good theory about this, it just popped into my head. "Cure for mankind."

If women are the cure... ?

I know we have not been destroying women Laughing I'm just thinking out loud (well, writing what I am thinking without thinking about it.)


_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Sun Mar 25, 2007 2:15 pm    Post subject: Reply with quote

janesalteredstates wrote:
Wait.
Holy crap.

OK, "the cure" for XSCID is the X chromosome, if we were talking all poetically or trying to be obtuse. No? Does that make any sense?

I don't even have a good theory about this, it just popped into my head. "Cure for mankind."

If women are the cure... ?

I know we have not been destroying women Laughing I'm just thinking out loud (well, writing what I am thinking without thinking about it.)



Maybe "J" is THE CURE for "men" being "kind" - or for being men Shocked

Edit: Because I made absolutely no sense - synapses were'nt firing yet this morning.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess


Last edited by Luminous on Sun Mar 25, 2007 4:22 pm; edited 2 times in total
Back to top
View user's profile Send private message Visit poster's website
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Sun Mar 25, 2007 2:18 pm    Post subject: Reply with quote

Are you making fun of me? Laughing
_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
chershaytoute
Moderator


Joined: 16 Jan 2007
Posts: 1877
Location: Oregon with an ocean view...across the neighbors' cow pasture, wow!

PostPosted: Sun Mar 25, 2007 3:59 pm    Post subject: Reply with quote

Please point me again for re-reading on XSCID?

That sounds like an intriguing point to explore, but...can't explore if I can't remember where, and from the feel of it, I have a migraine approaching... <sigh>
_________________
Diane, or cher, or even chershaytoute, but "Hey, you!" works, too...

WWggD - let's make the Breeniverse a better place to live...

Thanks to giddeanx for the coolest personal glue stick ever!
Back to top
View user's profile Send private message Send e-mail
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Sun Mar 25, 2007 4:13 pm    Post subject: Reply with quote

chershaytoute wrote:
Please point me again for re-reading on XSCID?

That sounds like an intriguing point to explore, but...can't explore if I can't remember where, and from the feel of it, I have a migraine approaching... <sigh>


No problemo. Sorry about your migraine. I get those too Sad Awful things.

OK, here you go:

This Side of Paradise

deagol's amazingly thorough explanation of how we cam upon XSCID
After that you'll find posts about the disorder(? is it a disorder? Defect?).

Hope that helps. Smile And take some pain killers.



Edit - We need to update the JPedia. Especially the puzzle recaps. *runs away*
_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Sun Mar 25, 2007 4:27 pm    Post subject: Reply with quote

janesalteredstates wrote:

Edit - We need to update the JPedia. Especially the puzzle recaps. *runs away*


Hope you're running away to make the needed edits Razz Everyone, feel free to join in - it's a big job keeping this thing up to date!
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Sun Mar 25, 2007 4:34 pm    Post subject: Reply with quote

Uhm... yeah, that's what I did. Liar

No, seriously, when I finish this ridiculous Logic homework Confused I'll see what I can do.
_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Sun Mar 25, 2007 5:23 pm    Post subject: Reply with quote

Logic HW? need any help? Smile
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Sun Mar 25, 2007 5:59 pm    Post subject: Reply with quote

Are you familiar with Symbolic Logic? (maybe this should be a PM thing Laughing )
_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Mon Apr 09, 2007 7:54 pm    Post subject: Reply with quote

A summary of the "Dei Sub Numine Viget" puzzle. This seemed a lot harder at the time Smile

Drop contents:
Quote:
1 white envelope
1 plastic bag
8 stones (looks like granite pebbles)
2 vials (J-5 and J-6)
1 library catalog card

On the outside of the envelope it says "From Debrowski." The front of the library card catalog says:
Quote:
(SQ)
QD40
.I536
1985

International Conference on Chemical
Education (8th : 1985 : Tokyo,
Japan) Widening the scope of
Chemistry... 1987.

Union of Pure and Applied Chemistry in
conjunction with the Chemical Society
of Japan"--P. [ii].
Includes bibliographies.
ISBN 0-632-01537-3

1. Chemistry--Study and teaching --
Congress. I. Takeuchi, Yoshito.
1934- II. International Union of
Pure and applied Chemistry. III.
Nihon Kagakkai, IV. Title.

870623 870622 NjP
ZG /ZG A* 87-B28379
86-26421

SQm
E000271

On the back it says (all hand written):
Code:
You should know what to do. I suppose it is time to tell you that what you have been destroying is
IKYOIYK
1(+ 8) 3(- 8) 5(+ 16) 3(- 16) 6(+ 16) 2(- 16) 7(+ 24)

There are eight stones, and the book is the 8th ICCE conference. Walter gave us a series of hints:
Quote:
(The shift +24) provides a multiplicity of clues.
Your comments aren't entirely off base.
It is tough being an Octalgenarian.
You kids may be young now, but you will eventually Convert to be like me, no matter how Plain you start.

Converting the text IKYOIYK into octal gives:
Code:
111113131117111131113

Reading this as 1=A, 2=B, 3=C, etc. gives:
Code:
AAAAACACAAAGAAAACAAAC

which codon/shift decrypts as:
Code:
Lysine_Asparagine_Threonine_Lysine_Lysine_Threonine_Asparagine (aminoacid names)
1        3            5       3         6  2              7    (number code)
LPOSEHG
+8 -8 +16 -16 +16 -16 +24 (shifts)
THECURE

So we are destroying "The Cure".
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page Previous  1, 2, 3 ... 12, 13, 14
Page 14 of 14

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP