Lonelygirl15 :: View topic - [Puzzle] JayNineteen Simultaneous Updates [6/4/07]

Lonelygirl15
Forum to post messages about Bree and Danielbeast

FAQ

Memberlist

Usergroups

Profile

[Puzzle] JayNineteen Simultaneous Updates [6/4/07]
Goto page Previous 1, 2, 3, 4, 5 Next

Lonelygirl15 Forum Index -> Facility J: Archive

View previous topic :: View next topic

Author

Message

phipunk
Casual Observer

Joined: 23 May 2007
Posts: 105
Location: Berkeley, CA

Posted: Tue Jun 05, 2007 11:00 am Post subject:

deagol wrote:

phipunk wrote:

NICE! Did you try BLASTing it? There are 991 triples by my count (2973 total bases), so we're going to have to winnow it down considerably to get the 48 proteins we're looking for.

I did, but I have no idea what I'm doing or what I'm looking for, and there's so many ways to search.

http://130.14.29.110/BLAST/

I clicked on "nucleotide blast" and I think I looked for human DNA and it found something near the end of the sequence that matched a bit of chromosome 5, I think. No idea what's up with that.

Searched again now against the mouse genome, and found a big chunk matching chromosome 12 of mice.

Did you try aligning it with the recently sequenced Phoenix genome? Wink

_________________
scientia ex silico

phipunk
Casual Observer

Joined: 23 May 2007
Posts: 105
Location: Berkeley, CA

Posted: Tue Jun 05, 2007 11:07 am Post subject:

deagol wrote:

Decrypt again with key: "To understand the future, look to the past."

Ah, now I get it. "The key to knowledge is understanding" --> "To understand the future, look to the past". Although it should probably be "One of the keys to knowledge is understanding; the other one is gibberish."
_________________
scientia ex silico

deagol
Thor's Hammer

Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

Posted: Tue Jun 05, 2007 11:13 am Post subject:

Ok I think I found the right place to cut it. On a hunch, I decided to search for our own GAATTC sequence from the rings. Just a simple text search, not any of those fancy tools (BLAST or NEBcutter) with make me feel like I'm in front of a 747 instrument panel. So anyways, there's exactly two instances of our plasmid marker, so I'm selecting the DNA sequence that's flanked by them.

Code:

GAATTC
TACTGCTCTGTTACTCTTTGCTACACTGACATGTTTGTGAGTGAAACA
CAAATCTGGCCTACATGCACATCCAAAGACACAGTAGGTCTAAACACA
AAGTTAGTGTTTGTACAGTCACATCGTTTCTCATTGTCTCGTCATTAC
GAATTC

This is exactly 144 bases, just what we needed. The aminoacid sequence:

Code:

Y C S V T L C Y T D Met F V S E T Q I W P T C T S K D T V G L N T K L V F V Q S H R F S L S R H Y

So far I did the first 16 decoding numbers (there must be an automated way of obtaining the aminoacid full names so I can plug them into our facilityj_decoder, but I haven't found one so I'm stuck to building the list by hand), and the resulting string is:

Code:

BFGBGFBGEAEABGCB
-+-+

Now this doesn't look as noisy. I've marked the letters that came from those suspicious (-0) (+0) (-0) (+0) shifts which remind me of the OOOOOOOCOOOO puzzle (*gulp*).

Last edited by deagol on Tue Jun 05, 2007 11:19 am; edited 2 times in total

deagol
Thor's Hammer

Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

Posted: Tue Jun 05, 2007 11:15 am Post subject:

phipunk wrote:

Did you try aligning it with the recently sequenced Phoenix genome? Wink

Exactly what I did after getting lost in BLAST. Did you try it?

Aja
Lonely Fan

Joined: 05 Dec 2006
Posts: 241
Location: California, baby.

Posted: Tue Jun 05, 2007 11:27 am Post subject:

deagol wrote:

Code:

GAATTC
TACTGCTCTGTTACTCTTTGCTACACTGACATGTTTGTGAGTGAAACA
CAAATCTGGCCTACATGCACATCCAAAGACACAGTAGGTCTAAACACA
AAGTTAGTGTTTGTACAGTCACATCGTTTCTCATTGTCTCGTCATTAC
GAATTC

This is exactly 144 bases, just what we needed. The aminoacid sequence:

Code:

Y C S V T L C Y T D Met F V S E T Q I W P T C T S K D T V G L N T K L V F V Q S H R F S L S R H Y

Code:

BFGBGFBGEAEABGCB
-+-+

Now this doesn't look as noisy. I've marked the letters that came from those suspicious (-0) (+0) (-0) (+0) shifts which remind me of the OOOOOOOCOOOO puzzle (*gulp*).

I did all 48 and as long as I didn't make any mistakes, you get:

Code:

BFGBGFBGEAEABGCBEFBGCBEBBFGAEABGFBGEBEFBGCBGFBGD
-+-+ +- + - +

_________________
Hey... Aja!
You can find me on MySpace, MyTube, MyIRC and now MyBebo!

deagol
Thor's Hammer

Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

Posted: Tue Jun 05, 2007 12:04 pm Post subject:

Aja wrote:

I did all 48 and as long as I didn't make any mistakes, you get:

Code:

BFGBGFBGEAEABGCBEFBGCBEBBFGAEABGFBGEBEFBGCBGFBGD
-+-+ +- + - +

Thanks Aja! I did it all just in case and got the same. Now what?

ignatzmouse
Enthusiastic Fan

Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

Posted: Tue Jun 05, 2007 12:16 pm Post subject:

Boy that was fast, I blinked and I missed it...

deagol wrote:

Aja wrote:

I did all 48 and as long as I didn't make any mistakes, you get:

Code:

BFGBGFBGEAEABGCBEFBGCBEBBFGAEABGFBGEBEFBGCBGFBGD
-+-+ +- + - +

Thanks Aja! I did it all just in case and got the same. Now what?

A-G == musical notation? Or would that be Maddison Atkins?
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?

phipunk
Casual Observer

Joined: 23 May 2007
Posts: 105
Location: Berkeley, CA

Posted: Tue Jun 05, 2007 12:20 pm Post subject:

ignatzmouse wrote:

Boy that was fast, I blinked and I missed it...

deagol wrote:

Aja wrote:

I did all 48 and as long as I didn't make any mistakes, you get:

Code:

BFGBGFBGEAEABGCBEFBGCBEBBFGAEABGFBGEBEFBGCBGFBGD
-+-+ +- + - +

Thanks Aja! I did it all just in case and got the same. Now what?

A-G == musical notation? Or would that be Maddison Atkins?

Yes, I think so! And +/- indicates sharps and flats!
_________________
scientia ex silico

phipunk
Casual Observer

Joined: 23 May 2007
Posts: 105
Location: Berkeley, CA

Posted: Tue Jun 05, 2007 12:20 pm Post subject:

deagol wrote:

phipunk wrote:

Did you try aligning it with the recently sequenced Phoenix genome? Wink

Exactly what I did after getting lost in BLAST. Did you try it?

Yep. The chromosomes it aligned with were all numbered 1 through 8, so I subtracted 1 from everything and converted from octal to ascii, giving me a perl script that outputs the very same sequence that you and Aja decoded!

Seriously though, great work on the slicing and dicing. I can't believe how fast this is going forward.
_________________
scientia ex silico

deagol
Thor's Hammer

Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

Posted: Tue Jun 05, 2007 1:00 pm Post subject:

ignatzmouse wrote:

Boy that was fast, I blinked and I missed it...

Haha yeah, for a change I went to sleep early last night, so I missed the first part. Hey you'd probably enjoy the aha! moment with the frequency crack. Here, I'll show you the way:

1. Go here
2. In the box, paste the gobbledygook from Lum's post and hit the "Break" button.
3. Notice the controls to increase the key size (period). It starts at a single letter but obviously you should increase it. Do that and switch between the different letters in the key (position), and notice how the frecuencies of the highlighted letters change. You can slide the histogram left or right to try to match the english histogram in blue, but don't waste too much time trying this since this message isn't in english.
4. Now keep increasing the key length and try not to yawn at the boring, flat histograms. Keep going... yeah, I was about to give up as well when, out of nowhere... ba-boom! There it is! For a second, it feels like you made a mistake or something. Of course you realize what's going on right away, and you shift to match what you're thinking. Yes, it fits!
5. When you try the next letter, don't be disheartened by what happens. Keep sliding and matching as best you can. Later you'll get another perfect match, and in the end you'll understand what the fortunate glitch was. Realize that this tool only lets you crack keys up to 20 characters long and the key we're looking for is 34 characters long. It was a close call with it happening only until the 17-characters long (half) pseudo-key.

If this sounds too boring you're free to ignore it. I realize I'm a bit obsessed with this little tool. I really like it though.

ignatzmouse wrote:

Code:

BFGBGFBGEAEABGCBEFBGCBEBBFGAEABGFBGEBEFBGCBGFBGD
-+-+ +- + - +

A-G == musical notation? Or would that be Maddison Atkins?

Ooh good thinking! Well, who says one J can't pick up a trick from another J... Wink

I'll check it out, but first: lunch! Drool

ignatzmouse
Enthusiastic Fan

Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

Posted: Tue Jun 05, 2007 1:33 pm Post subject:

deagol wrote:

ignatzmouse wrote:

Boy that was fast, I blinked and I missed it...

Haha yeah, for a change I went to sleep early last night, so I missed the first part. Hey you'd probably enjoy the aha! moment with the frequency crack. Here, I'll show you the way:

OK, that's quite a neat tool. Pity it's limited to key size 20, can't have everything.

deagol wrote:

ignatzmouse wrote:

Code:

BFGBGFBGEAEABGCBEFBGCBEBBFGAEABGFBGEBEFBGCBGFBGD
-+-+ +- + - +

A-G == musical notation? Or would that be Maddison Atkins?

Ooh good thinking! Well, who says one J can't pick up a trick from another J... Wink

I'll check it out, but first: lunch! Drool

This doesn't smell right to me (musical notation being a bit far from the hard biochem we were dealing with a couple of months back) but you never know.
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?

phipunk
Casual Observer

Joined: 23 May 2007
Posts: 105
Location: Berkeley, CA

Posted: Tue Jun 05, 2007 1:35 pm Post subject:

phipunk wrote:

ignatzmouse wrote:

A-G == musical notation? Or would that be Maddison Atkins?

Yes, I think so! And +/- indicates sharps and flats!

On the other hand, that would yield both E-flat and E-sharp, the latter of which is better known as F. Perhaps I jumped the gun on that interpretation of + and -.
_________________
scientia ex silico

ignatzmouse
Enthusiastic Fan

Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

Posted: Tue Jun 05, 2007 1:38 pm Post subject:

Oh, and here's a perl script I wrote which automates the codon/shift decryption. Command line only I'm afraid -- it takes the DNA sequence as the first argument, and the shifts as the second.

Code:

#! /usr/bin/perl

$codons = shift();
$shifts = shift();

print "codons: $codons\n";
print "shifts: $shifts\n";

%names = (
"TTT", "PHENYLALANINE",
"TTC", "PHENYLALANINE",
"TTA", "LEUCINE",
"TTG", "LEUCINE",
"TCT", "SERINE",
"TCC", "SERINE",
"TCA", "SERINE",
"TCG", "SERINE",
"TAT", "TYROSINE",
"TAC", "TYROSINE",
"TAA", "OCHRE",
"TAG", "AMBER",
"TGT", "CYSTEINE",
"TGC", "CYSTEINE",
"TGA", "OPAL",
"TGG", "TRYPTOPHAN",
"CTT", "LEUCINE",
"CTC", "LEUCINE",
"CTA", "LEUCINE",
"CTG", "LEUCINE",
"CCT", "PROLINE",
"CCC", "PROLINE",
"CCA", "PROLINE",
"CCG", "PROLINE",
"CAT", "HISTIDINE",
"CAC", "HISTIDINE",
"CAA", "GLUTAMINE",
"CAG", "GLUTAMINE",
"CGT", "ARGININE",
"CGC", "ARGININE",
"CGA", "ARGININE",
"CGG", "ARGININE",
"ATT", "ISOLEUCINE",
"ATC", "ISOLEUCINE",
"ATA", "ISOLEUCINE",
"ATG", "METHIONINE",
"ACT", "THREONINE",
"ACC", "THREONINE",
"ACA", "THREONINE",
"ACG", "THREONINE",
"AAT", "ASPARAGINE",
"AAC", "ASPARAGINE",
"AAA", "LYSINE",
"AAG", "LYSINE",
"AGT", "SERINE",
"AGC", "SERINE",
"AGA", "ARGININE",
"AGG", "ARGININE",
"GTT", "VALINE",
"GTC", "VALINE",
"GTA", "VALINE",
"GTG", "VALINE",
"GCT", "ALANINE",
"GCC", "ALANINE",
"GCA", "ALANINE",
"GCG", "ALANINE",
"GAT", "ASPARTICACID",
"GAC", "ASPARTICACID",
"GAA", "GLUTAMICACID",
"GAG", "GLUTAMICACID",
"GGT", "GLYCINE",
"GGC", "GLYCINE",
"GGA", "GLYCINE",
"GGG", "GLYCINE"
);

$output = "";

while($codons =~ s/\s*(\S\S\S)\s*//) {
$codon = $1;
die "No such codon." unless $name = $names{$codon};
die "No such shift" unless $shifts =~ s/\s*(\d+)$(\+?-?\d+)$\s*//;
$len = length($name);
$index = $1;
$offset = $2;
$char = substr($name,($index - 1) % $len,1);
$result = chr(((ord($char) - ord("A") + $offset) % 26) + ord("A"));
print "codon: $codon\n";
print "name: $name\n";
print "offset: $offset\n";
print "index: $index\n";
print "len: $len\n";
print "char: $char\n";
print "result: $result\n";
$output .= $result;
}

print "output: $output\n";

_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?

deagol
Thor's Hammer

Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

Posted: Tue Jun 05, 2007 2:20 pm Post subject:

phipunk wrote:

In the meantime, perhaps there's a clue right under our noses

Quote:

The Key to Knowledge is Understanding

Where did this quote come from? I can't find it in any of the profiles or archived correspondence.

Aja
Lonely Fan

Joined: 05 Dec 2006
Posts: 241
Location: California, baby.

Posted: Tue Jun 05, 2007 2:25 pm Post subject:

It was the title of the second Craigslist posting (the one with all the gobbledygook), which unfortunately has since been tagged for removal. _________________ Hey... Aja! You can find me on MySpace, MyTube, MyIRC and now MyBebo!

Display posts from previous:

	Lonelygirl15 Forum Index -> Facility J: Archive	All times are GMT - 6 Hours Goto page Previous 1, 2, 3, 4, 5 Next
Page 2 of 5

Jump to:

You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum

Protected by Anti-Spam ACP