View previous topic :: View next topic |
Author |
Message |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Sat May 12, 2007 8:43 pm Post subject: |
|
|
Last Login: 9 minutes ago
 |
|
Back to top |
|
 |
ShardinsKitten Devoted Fan

Joined: 28 Jan 2007 Posts: 934
|
Posted: Sat May 12, 2007 8:55 pm Post subject: |
|
|
mouse I dunno if you did this already, but when you get a response would you mind posting both of them in the archive of messages too please.
so I was sitting here thinking and Jeromy for maddy kept saying we should be asking more why, how type questions, maybe we should try looking more that way here too?
I dunno I wish I had more time to really sit down and review this puzzle but I don't, so ignore this comment if it makes no sense what so ever. _________________ I know I'm an acquired taste: I'm anchovies. And not everyone wants those hairy little things. If I was potato chips, I could go more places. -Tori Amos |
|
Back to top |
|
 |
ignatzmouse Enthusiastic Fan

Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Sun May 13, 2007 6:19 am Post subject: |
|
|
ignatzmouse wrote: | OK, I sent:
ignatzmouse wrote: | To: JayNineteen
Sent: May 12, 2007
Read: —
Subject: ijoopyaattzbqkipyerggjqa
Message:
The volunteer corps has been going crazy over your profile.
Going crazy, I say crazeeeee!
All attempts at decryption have gone nowhere.
Can you give us a hint?
? |
Lame "TGAC?" meaning give us a hint whether it's an encrypted DNA sequence we're looking for. We shall see if we get a reply. |
And the reply:
JayNineteen wrote: | Sent: May 12, 2007
Subject: Re: ijoopyaattzbqkipyerggjqa
Message:
iterate  |
_________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
 |
ignatzmouse Enthusiastic Fan

Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Sun May 13, 2007 6:22 am Post subject: |
|
|
ShardinsKitten wrote: | mouse I dunno if you did this already, but when you get a response would you mind posting both of them in the archive of messages too please. |
Done! _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
 |
ShardinsKitten Devoted Fan

Joined: 28 Jan 2007 Posts: 934
|
Posted: Sun May 13, 2007 12:38 pm Post subject: |
|
|
thanks mouse! i just know it helps some of our players to have stuff all together.
Quote: | it·er·ate /ˈɪtəˌreɪt/ Pronunciation Key - Show Spelled Pronunciation[it-uh-reyt] Pronunciation Key - Show IPA Pronunciation verb, -at·ed, -at·ing.
–verb (used with object)
1. to utter again or repeatedly.
2. to do (something) over again or repeatedly.
–verb (used without object)
3. to operate or be applied repeatedly, as a linguistic rule or mathematical formula.
[Origin: 1525–35; < L iterātus, ptp. of iterāre to repeat, equiv. to iter- (s. of iterum) again + -ātus -ate1] |
hmmm _________________ I know I'm an acquired taste: I'm anchovies. And not everyone wants those hairy little things. If I was potato chips, I could go more places. -Tori Amos |
|
Back to top |
|
 |
ShardinsKitten Devoted Fan

Joined: 28 Jan 2007 Posts: 934
|
Posted: Sun May 13, 2007 3:51 pm Post subject: |
|
|
ok so me and lum are talking in the chat about this right now...
We are thinking we need to repeat some step in solving this...
Maybe even only once... or maybe more.. I'm just not sure which step it could be
I still think it is strange that he used iterate instead of reiterate, and I'm wondering why... _________________ I know I'm an acquired taste: I'm anchovies. And not everyone wants those hairy little things. If I was potato chips, I could go more places. -Tori Amos |
|
Back to top |
|
 |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Sun May 13, 2007 5:30 pm Post subject: |
|
|
Why do you think he should've said reiterate?
Iteration is a well known math/computation/programming technique. |
|
Back to top |
|
 |
ShardinsKitten Devoted Fan

Joined: 28 Jan 2007 Posts: 934
|
Posted: Sun May 13, 2007 7:07 pm Post subject: |
|
|
heh maybe cuz I never hear it lol
Quote: | [17:31] <@LumBack> K, so what I was thinking about the puzzle.
[17:31] <@LumBack> I was thinking that the Crowley references identify the keys
[17:31] <@LumBack> and that the ijoopy . . . . is the message text
[17:32] <@LumBack> cause it syncs mathmatically with the decrypt numbers.
[17:32] <@LumBack> either 4 to each #(+#)
[17:32] <@LumBack> or three to the #'s with a start and stop codon.
[17:33] <@LumBack> So, hang on, I'm getting something.
[17:34] <@LumBack> So when we use Every man and every woman is a star
[17:34] <@LumBack> to decrypt ijoopyaattzbqkipyerggjqa
[17:34] <@LumBack> we get eokxrmantgwxvgrrcqfgtbya
[17:34] <@LumBack> Which is, as best we can tell, nonsense.
[17:35] <@LumBack> So I was looking at that and wondering
[17:35] <@LumBack> If Jay wanted to make a harder puzzle
[17:35] <@LumBack> so Deag and Mouse couldn't just crack it immediately
[17:35] <@LumBack> how would he mask the sequence
[17:35] <@LumBack> so they couldn't force decrypt it?
[17:36] <@SultryKitten> so you think we need to decrypt that again with the other crowely thing?
[17:36] <@LumBack> Anyway, that's as far as I got |
in case someone can finish before I get the chance to tonight.
We were thinking maybe we need to decrypt it again with our second crowely hint. _________________ I know I'm an acquired taste: I'm anchovies. And not everyone wants those hairy little things. If I was potato chips, I could go more places. -Tori Amos |
|
Back to top |
|
 |
ignatzmouse Enthusiastic Fan

Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Sun May 13, 2007 8:59 pm Post subject: |
|
|
Iterate is indeed a standard computer science term.
Most likely a red herring, but one of its uses comes from regular expressions, where "repeat X zero or more times" is written "X*", and pronounced "X star". Hmm. This use of "star" is also called "Kleene closure". _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
 |
Musique Casual Observer

Joined: 22 Mar 2007 Posts: 68
|
Posted: Sun May 13, 2007 9:02 pm Post subject: |
|
|
ignatzmouse wrote: | Iterate is indeed a standard computer science term.
Most likely a red herring, but one of its uses comes from regular expressions, where "repeat X zero or more times" is written "X*", and pronounced "X star". Hmm. This use of "star" is also called "Kleene closure". |
"Every man and every woman is a star." I think you're on to something. |
|
Back to top |
|
 |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Mon May 14, 2007 1:26 am Post subject: |
|
|
Not sure if this is progress. This is in pseudocode in the hope that more people can follow:
Code: | key := ijoopyaattzbqkipyerggjqa
msg := everymanandeverywomanisa
FOR iteration = 1 TO 6
msg := encrypt (msg, key)
print (iteration+":"+msg)
ENDFOR
Output:
1:mesfnkantgcfloznusdgtria
2:ungtcianmzbgbyhcswumzaya
3:cwuhrganfsahriprqalsfjoa
4:kfivgeanylzihsxgoecylsea
5:sowjvcanreyjxcfvmiterbua
6:axkxkaankxxknmnkkmkkxkka
|
What I'm doing is just feeding the result back as the input message on the encryption machine (that's how I interpret the 'iterate' hint), starting with the "Every man and..." text. Notice the last iteration's result consists of (almost) only four letters {a, k, n, x}. The exceptions are 2 letters 'm' in the 14th and 18th positions. Also note that n=rot13(a) and x=rot13(k), and a=0, k=10.
I don't know where this is leading, but I'm pretty sure it's not a random coincidence. I tried it with some other initial text and didn't get anything, which means there must be a special relationship between the ijoopy key and the Crowley quote that after 6 iterations (almost) produces a message based on 4 letters, just like DNA codons (or the IKOY language). |
|
Back to top |
|
 |
ShardinsKitten Devoted Fan

Joined: 28 Jan 2007 Posts: 934
|
Posted: Mon May 14, 2007 2:06 am Post subject: |
|
|
ok this is going to be a really really stupid question... so you're warned
but why is important that a=0 and k=10?
I guess, why would we be taking them back to numbers?
and Why isn't x as important as those two letters?
***ends stupid questions for now*** _________________ I know I'm an acquired taste: I'm anchovies. And not everyone wants those hairy little things. If I was potato chips, I could go more places. -Tori Amos |
|
Back to top |
|
 |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Mon May 14, 2007 2:50 am Post subject: |
|
|
Those are not stupid questions at all. I thought that the fact that the letters could be paired like that [a,n] and [k,x], and a representative from each pair could be identified as a=0 and k=10, and these only involved zeroes and ones... see where I'm going? Yea, I never know when to stop looking for patterns.
But I didn't mean to skew you in that direction, just thought I'd mention all the paths I had explored. It's a good thing that you have the sense to pause for a bit at the apparent clearing in the jungle, which is the 4 (or 5) letters including those x's. I'm still not sure what to do about it. |
|
Back to top |
|
 |
ignatzmouse Enthusiastic Fan

Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Mon May 14, 2007 6:00 am Post subject: |
|
|
deagol wrote: | Not sure if this is progress. This is in pseudocode in the hope that more people can follow:
Code: | key := ijoopyaattzbqkipyerggjqa
msg := everymanandeverywomanisa
FOR iteration = 1 TO 6
msg := encrypt (msg, key)
print (iteration+":"+msg)
ENDFOR
Output:
1:mesfnkantgcfloznusdgtria
2:ungtcianmzbgbyhcswumzaya
3:cwuhrganfsahriprqalsfjoa
4:kfivgeanylzihsxgoecylsea
5:sowjvcanreyjxcfvmiterbua
6:axkxkaankxxknmnkkmkkxkka
|
What I'm doing is just feeding the result back as the input message on the encryption machine (that's how I interpret the 'iterate' hint), starting with the "Every man and..." text. |
Bingo.
Code: | key := everymanandeverywomanisa
msg := ijoopyaattzbqkipyerggjqa
FOR iteration = 1 TO 2
msg := decrypt (msg, key)
print (iteration+":"+msg)
ENDFOR
Output:
1:eokxrmantgwxvgrrcqfgtbya
2:atggtaaattttacatgctggtga
|
Hooray! _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
 |
ignatzmouse Enthusiastic Fan

Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Mon May 14, 2007 6:04 am Post subject: |
|
|
Decodes to:
Quote: | (Start)VECTOR(Stop) |
Anyone want to try this as a myspace last name? _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
 |
|