Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

Sandi Star - "Division Of Power" - July 17, 2007
Goto page Previous  1, 2, 3  Next
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Wed Jul 18, 2007 9:54 pm    Post subject: Reply with quote

I don't quite see how BLAST is going to do us any good here.

Elaborate on your idea, perhaps, phipunk?
_________________
I'm canon; the Creators just don't know it yet.
Back to top
View user's profile Send private message
phipunk
Casual Observer


Joined: 23 May 2007
Posts: 105
Location: Berkeley, CA

PostPosted: Wed Jul 18, 2007 10:01 pm    Post subject: Reply with quote

TOSG wrote:
I don't quite see how BLAST is going to do us any good here.

Elaborate on your idea, perhaps, phipunk?


It might be that this is a sequence from a real genome; or perhaps most of it is from a genome, and part of it is another clue.
_________________
scientia ex silico
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Jul 18, 2007 10:07 pm    Post subject: Reply with quote

Alright I decided a proof was needed for this vexing conundrum:

200|600, 40|200, 8|40 thus 8|600... damit what's wrong?

letme try again:
25|100, 100|600 thus 25|600
600/25 = (4*600)/(4*25) = 2400/100 = 24
so 24|600, 8|24 thus... arrrgg, I'm sorry guys!

*looks at the pretty colored dots*
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Wed Jul 18, 2007 10:09 pm    Post subject: Reply with quote

phipunk wrote:
TOSG wrote:
I don't quite see how BLAST is going to do us any good here.

Elaborate on your idea, perhaps, phipunk?


It might be that this is a sequence from a real genome; or perhaps most of it is from a genome, and part of it is another clue.


Okay, I'll buy that.

I'm a bit too lazy to figure out all 24 sequences, though. Laughing But if someone gives them to me, I'd be happy to BLAST them.
_________________
I'm canon; the Creators just don't know it yet.
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Jul 18, 2007 10:16 pm    Post subject: Reply with quote

ignatzmouse wrote:

It's a 30x10 grid of four colors [...] each color is two bits [...] this would be 600 bits, which isn't a multiple of 8 [...]

Ok had to go back to the original statement to see where I went wrong...

30x10x2 = (2x15)x(2x5)x2 = 2x2x2x(15x5) = ... *explodes*

Laughing ok that's the last jab I'll make. I know I've been in that spot, and will be many times again, so enough of that.
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Wed Jul 18, 2007 10:45 pm    Post subject: Reply with quote

Haha, deag, you're vicious. Remind me never to make a math error around you. Laughing
_________________
I'm canon; the Creators just don't know it yet.
Back to top
View user's profile Send private message
phipunk
Casual Observer


Joined: 23 May 2007
Posts: 105
Location: Berkeley, CA

PostPosted: Thu Jul 19, 2007 12:12 am    Post subject: Reply with quote

deagol wrote:
ignatzmouse wrote:

It's a 30x10 grid of four colors [...] each color is two bits [...] this would be 600 bits, which isn't a multiple of 8 [...]

Ok had to go back to the original statement to see where I went wrong...

30x10x2 = (2x15)x(2x5)x2 = 2x2x2x(15x5) = ... *explodes*

Laughing ok that's the last jab I'll make. I know I've been in that spot, and will be many times again, so enough of that.


Wait, those numbers were in base 10? I thought we were in base 9! Of course 8 divides 600.

<hangs head in shame for not cluing in on this>
_________________
scientia ex silico
Back to top
View user's profile Send private message
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Thu Jul 19, 2007 6:01 am    Post subject: Reply with quote

phipunk wrote:
deagol wrote:
ignatzmouse wrote:

It's a 30x10 grid of four colors [...] each color is two bits [...] this would be 600 bits, which isn't a multiple of 8 [...]

Ok had to go back to the original statement to see where I went wrong...

30x10x2 = (2x15)x(2x5)x2 = 2x2x2x(15x5) = ... *explodes*

Laughing ok that's the last jab I'll make. I know I've been in that spot, and will be many times again, so enough of that.


Wait, those numbers were in base 10? I thought we were in base 9! Of course 8 divides 600.

<hangs head in shame for not cluing in on this>

Er, my mistake. It's 300 that isn't a multiple of 8, d'oh!
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
ApotheosisAZ
The Order of Denderah


Joined: 08 Nov 2006
Posts: 3175
Location: Snoresville, Baby.

PostPosted: Thu Jul 19, 2007 2:42 pm    Post subject: Reply with quote

Just tossing out an idea...

The effect added to the puzzle is a rippled-wave. Perhaps this indicates a numerical order of the colored blocks according to each colors wavelength, or place in the visible spectrum.

The simplest numerical assignment from shortest wavelength to longest would be:

Code:
b = 1
g = 2
y = 3
r = 4

_________________
Official Jester of the LG15 Defense Force!
Back to top
View user's profile Send private message
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Fri Jul 20, 2007 8:08 am    Post subject: Reply with quote

Yet another way to generate random-looking text...

I tried seeing if we can treat each three-color block as a six-bit value. This means picking a mapping from {b,g,r,y} into {00,01,10,11} (e.g. b=00,g=01,r=10,y=11), applying it to each three-color block to get a six-bit value (e.g. "grr" produces "011010") then sticking "01" on the front and converting to ASCII (e.g. "01011010" is "Z").

Here's a perl script which tries all 24 possible mappings:
Code:
#!/usr/bin/perl

$ctext = (
    "ybbybrrrybbbbyyyrrbryrbrbbbbbg"
  . "rrybrrbgrrrbrbbrrbryyyrrbyygry"
  . "bbrrrbbgyrbybyrbgbyrrbgbbrbyry"
  . "bybbybryrbgrrgybrggrrbbrgrbbbr"
  . "rrbbrrybgbyyrbbrrybgyrbrrbbrrb"
  . "rbbyrbbrbbyrrbbbgrbbgbrbbbbbrb"
  . "rbbgbyrybbyrbrybyrbrbrbryrbrgr"
  . "bgbryyygrbrbybbyryyrgrbyryrgbb"
  . "gbbbrybrbyrbbrgrggrgbyrrbbybyr"
  . "ybybrbryrbrybbgrbygbrbgrrbyryr"
);

@digits = ( "00", "01", "10", "11" );

foreach $b (@digits) {
    foreach $g (@digits) {
        next if $g == $b;
        foreach $r (@digits) {
            next if $r == $b || $r == $g;
            foreach $y (@digits) {
                next if $y == $b || $y == $g || $y == $r;
                print "b=$b g=$g r=$r y=$y\n";
                $ptext = $ctext;
                $ptext =~ s/(...)/01\1/g;
                $ptext =~ s/b/$b/g;
                $ptext =~ s/g/$g/g;
                $ptext =~ s/r/$r/g;
                $ptext =~ s/y/$y/g;
                print pack "B*", $ptext;
                print "\n";
            }
        }
    }
}
Hey ho, it generates gibberish:
Code:

b=00 g=01 r=10 y=11
prk@OzKb@AkJFh`hozO[BhGcNDzDH{LLnFgIZBXBhJqO`kGb`h`xHN`FAH@H`SlNKNHbxfDovHp{ycnPPKHxIedzCNsHnKAcRFcn
...
Oh well, back to the drawing board.
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Fri Jul 20, 2007 9:11 am    Post subject: Reply with quote

Didn't phipunk say something like "unless it's six bits and they need to be padded with... no let's not go into that." Razz

(I did go into it, for the first few mappings, and got the same gibberish.)

At least it's not that "q:..@,7]/rL|" from before. Of course we're trying to force it into the nice ascii range. You should also keep an eye at the base64 box, in case something readable shows up there. e.g. bgry yields:
8 bit, no padding:
Code:
wyrAP6LiABrKGogov6PbCoHjOE6EI7MMuGnJaCYCoKxPgrHigo
g4IOgGBIAIgTsOLOIi4mEv2Iw75juQQLI4Jlk6DOzIuLBjSGju


6 bit, first 2 bits =01:
Code:
cHJrQE96S2JAQWtKRmhgaG96T1tCaEdjTkR6REh7TExuRmdJWkJYQmhKcU9ga0diYGhg
eEhOYEZBSEBIYFNsTktOSGJ4ZkRvdkhwe3ljblBQS0h4SWVkekNOc0huS0FjUkZjbg==
                  ^^^^


tOSG ? Shocked


Last edited by deagol on Fri Jul 20, 2007 9:18 am; edited 1 time in total
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
silverblue
Enthusiastic Fan


Joined: 28 Mar 2007
Posts: 280
Location: A land down under

PostPosted: Fri Jul 20, 2007 9:17 am    Post subject: Reply with quote

This puzzle makes me sad because I don't understand a second of it and it looks terribly frustrating... but you guys are freakin' awesome for persevering with all of this code-breakingness!

Applause
_________________
Yeah, you'd better run!
Back to top
View user's profile Send private message
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Fri Jul 20, 2007 10:46 am    Post subject: Reply with quote

deagol wrote:
Didn't phipunk say something like "unless it's six bits and they need to be padded with... no let's not go into that." Razz
Oops. Plagiarize, plagiarize, let no one else's work evade your eyes, etc.
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Fri Jul 20, 2007 11:19 am    Post subject: Reply with quote

TOSG wrote:
phipunk wrote:
TOSG wrote:
I don't quite see how BLAST is going to do us any good here.

Elaborate on your idea, perhaps, phipunk?


It might be that this is a sequence from a real genome; or perhaps most of it is from a genome, and part of it is another clue.


Okay, I'll buy that.

I'm a bit too lazy to figure out all 24 sequences, though. Laughing But if someone gives them to me, I'd be happy to BLAST them.

You may regret saying that, TOSG Smile
Code:
// b=A g=C r=G y=T
TAATAGGGTAAAATTTGGAGTGAGAAAAACGGTAGGACGGGAGAAGGAGTTTGGATTCGT
AAGGGAACTGATATGACATGGACAAGATGTATAATAGTGACGGCTAGCCGGAAGCGAAAG
GGAAGGTACATTGAAGGTACTGAGGAAGGAGAATGAAGAATGGAAACGAACAGAAAAAGA
GAACATGTAATGAGTATGAGAGAGTGAGCGACAGTTTCGAGATAATGTTGCGATGTGCAA
CAAAGTAGATGAAGCGCCGCATGGAATATGTATAGAGTGAGTAACGATCAGACGGATGTG
// b=A g=C r=T y=G
GAAGATTTGAAAAGGGTTATGTATAAAAACTTGATTACTTTATAATTATGGGTTAGGCTG
AATTTAACGTAGAGTACAGTTACAATAGTGAGAAGATGTACTTCGATCCTTAATCTAAAT
TTAATTGACAGGTAATTGACGTATTAATTATAAGTAATAAGTTAAACTAACATAAAAATA
TAACAGTGAAGTATGAGTATATATGTATCTACATGGGCTATAGAAGTGGTCTAGTGTCAA
CAAATGATAGTAATCTCCTCAGTTAAGAGTGAGATATGTATGAACTAGCATACTTAGTGT
// b=A g=G r=C y=T
TAATACCCTAAAATTTCCACTCACAAAAAGCCTACCAGCCCACAACCACTTTCCATTGCT
AACCCAAGTCATATCAGATCCAGAACATCTATAATACTCAGCCGTACGGCCAACGCAAAC
CCAACCTAGATTCAACCTAGTCACCAACCACAATCAACAATCCAAAGCAAGACAAAAACA
CAAGATCTAATCACTATCACACACTCACGCAGACTTTGCACATAATCTTCGCATCTCGAA
GAAACTACATCAACGCGGCGATCCAATATCTATACACTCACTAAGCATGACAGCCATCTC
// b=A g=G r=T y=C
CAACATTTCAAAACCCTTATCTATAAAAAGTTCATTAGTTTATAATTATCCCTTACCGTC
AATTTAAGCTACACTAGACTTAGAATACTCACAACATCTAGTTGCATGGTTAATGTAAAT
TTAATTCAGACCTAATTCAGCTATTAATTATAACTAATAACTTAAAGTAAGATAAAAATA
TAAGACTCAACTATCACTATATATCTATGTAGATCCCGTATACAACTCCTGTACTCTGAA
GAAATCATACTAATGTGGTGACTTAACACTCACATATCTATCAAGTACGATAGTTACTCT
// b=A g=T r=C y=G
GAAGACCCGAAAAGGGCCACGCACAAAAATCCGACCATCCCACAACCACGGGCCAGGTCG
AACCCAATGCAGAGCATAGCCATAACAGCGAGAAGACGCATCCTGACTTCCAACTCAAAC
CCAACCGATAGGCAACCGATGCACCAACCACAAGCAACAAGCCAAATCAATACAAAAACA
CAATAGCGAAGCACGAGCACACACGCACTCATACGGGTCACAGAAGCGGCTCAGCGCTAA
TAAACGACAGCAACTCTTCTAGCCAAGAGCGAGACACGCACGAATCAGTACATCCAGCGC
// b=A g=T r=G y=C
CAACAGGGCAAAACCCGGAGCGAGAAAAATGGCAGGATGGGAGAAGGAGCCCGGACCTGC
AAGGGAATCGACACGATACGGATAAGACGCACAACAGCGATGGTCAGTTGGAAGTGAAAG
GGAAGGCATACCGAAGGCATCGAGGAAGGAGAACGAAGAACGGAAATGAATAGAAAAAGA
GAATACGCAACGAGCACGAGAGAGCGAGTGATAGCCCTGAGACAACGCCGTGACGCGTAA
TAAAGCAGACGAAGTGTTGTACGGAACACGCACAGAGCGAGCAATGACTAGATGGACGCG
// b=C g=A r=G y=T
TCCTCGGGTCCCCTTTGGCGTGCGCCCCCAGGTCGGCAGGGCGCCGGCGTTTGGCTTAGT
CCGGGCCATGCTCTGCACTGGCACCGCTGTCTCCTCGTGCAGGATCGAAGGCCGAGCCCG
GGCCGGTCACTTGCCGGTCATGCGGCCGGCGCCTGCCGCCTGGCCCAGCCACGCCCCCGC
GCCACTGTCCTGCGTCTGCGCGCGTGCGAGCACGTTTAGCGCTCCTGTTGAGCTGTGACC
ACCCGTCGCTGCCGAGAAGACTGGCCTCTGTCTCGCGTGCGTCCAGCTACGCAGGCTGTG
// b=C g=A r=T y=G
GCCGCTTTGCCCCGGGTTCTGTCTCCCCCATTGCTTCATTTCTCCTTCTGGGTTCGGATG
CCTTTCCAGTCGCGTCACGTTCACCTCGTGCGCCGCTGTCATTAGCTAATTCCTATCCCT
TTCCTTGCACGGTCCTTGCAGTCTTCCTTCTCCGTCCTCCGTTCCCATCCACTCCCCCTC
TCCACGTGCCGTCTGCGTCTCTCTGTCTATCACTGGGATCTCGCCGTGGTATCGTGTACC
ACCCTGCTCGTCCTATAATACGTTCCGCGTGCGCTCTGTCTGCCATCGACTCATTCGTGT
// b=C g=G r=A y=T
TCCTCAAATCCCCTTTAACATACACCCCCGAATCAACGAAACACCAACATTTAACTTGAT
CCAAACCGTACTCTACGCTAACGCCACTATCTCCTCATACGAAGTCAGGAACCAGACCCA
AACCAATCGCTTACCAATCGTACAACCAACACCTACCACCTAACCCGACCGCACCCCCAC
ACCGCTATCCTACATCTACACACATACAGACGCATTTGACACTCCTATTAGACTATAGCC
GCCCATCACTACCAGAGGAGCTAACCTCTATCTCACATACATCCGACTGCACGAACTATA
// b=C g=G r=T y=A
ACCACTTTACCCCAAATTCTATCTCCCCCGTTACTTCGTTTCTCCTTCTAAATTCAAGTA
CCTTTCCGATCACATCGCATTCGCCTCATACACCACTATCGTTGACTGGTTCCTGTCCCT
TTCCTTACGCAATCCTTACGATCTTCCTTCTCCATCCTCCATTCCCGTCCGCTCCCCCTC
TCCGCATACCATCTACATCTCTCTATCTGTCGCTAAAGTCTCACCATAATGTCATATGCC
GCCCTACTCATCCTGTGGTGCATTCCACATACACTCTATCTACCGTCAGCTCGTTCATAT
// b=C g=T r=A y=G
GCCGCAAAGCCCCGGGAACAGACACCCCCTAAGCAACTAAACACCAACAGGGAACGGTAG
CCAAACCTGACGCGACTCGAACTCCACGAGCGCCGCAGACTAATGCATTAACCATACCCA
AACCAAGCTCGGACCAAGCTGACAACCAACACCGACCACCGAACCCTACCTCACCCCCAC
ACCTCGAGCCGACAGCGACACACAGACATACTCAGGGTACACGCCGAGGATACGAGATCC
TCCCAGCACGACCATATTATCGAACCGCGAGCGCACAGACAGCCTACGTCACTAACGAGA
// b=C g=T r=G y=A
ACCACGGGACCCCAAAGGCGAGCGCCCCCTGGACGGCTGGGCGCCGGCGAAAGGCAATGA
CCGGGCCTAGCACAGCTCAGGCTCCGCAGACACCACGAGCTGGTACGTTGGCCGTGCCCG
GGCCGGACTCAAGCCGGACTAGCGGCCGGCGCCAGCCGCCAGGCCCTGCCTCGCCCCCGC
GCCTCAGACCAGCGACAGCGCGCGAGCGTGCTCGAAATGCGCACCAGAAGTGCAGAGTCC
TCCCGACGCAGCCGTGTTGTCAGGCCACAGACACGCGAGCGACCTGCATCGCTGGCAGAG
// b=G g=A r=C y=T
TGGTGCCCTGGGGTTTCCGCTCGCGGGGGACCTGCCGACCCGCGGCCGCTTTCCGTTACT
GGCCCGGATCGTGTCGAGTCCGAGGCGTCTGTGGTGCTCGACCATGCAACCGGCACGGGC
CCGGCCTGAGTTCGGCCTGATCGCCGGCCGCGGTCGGCGGTCCGGGACGGAGCGGGGGCG
CGGAGTCTGGTCGCTGTCGCGCGCTCGCACGAGCTTTACGCGTGGTCTTCACGTCTCAGG
AGGGCTGCGTCGGCACAACAGTCCGGTGTCTGTGCGCTCGCTGGACGTAGCGACCGTCTC
// b=G g=A r=T y=C
CGGCGTTTCGGGGCCCTTGTCTGTGGGGGATTCGTTGATTTGTGGTTGTCCCTTGCCATC
GGTTTGGACTGCGCTGAGCTTGAGGTGCTCGCGGCGTCTGATTACGTAATTGGTATGGGT
TTGGTTCGAGCCTGGTTCGACTGTTGGTTGTGGCTGGTGGCTTGGGATGGAGTGGGGGTG
TGGAGCTCGGCTGTCGCTGTGTGTCTGTATGAGTCCCATGTGCGGCTCCTATGCTCTAGG
AGGGTCGTGCTGGTATAATAGCTTGGCGCTCGCGTGTCTGTCGGATGCAGTGATTGCTCT
// b=G g=C r=A y=T
TGGTGAAATGGGGTTTAAGATAGAGGGGGCAATGAAGCAAAGAGGAAGATTTAAGTTCAT
GGAAAGGCTAGTGTAGCGTAAGCGGAGTATGTGGTGATAGCAACTGACCAAGGACAGGGA
AAGGAATGCGTTAGGAATGCTAGAAGGAAGAGGTAGGAGGTAAGGGCAGGCGAGGGGGAG
AGGCGTATGGTAGATGTAGAGAGATAGACAGCGATTTCAGAGTGGTATTACAGTATACGG
CGGGATGAGTAGGACACCACGTAAGGTGTATGTGAGATAGATGGCAGTCGAGCAAGTATA
// b=G g=C r=T y=A
AGGAGTTTAGGGGAAATTGTATGTGGGGGCTTAGTTGCTTTGTGGTTGTAAATTGAACTA
GGTTTGGCATGAGATGCGATTGCGGTGATAGAGGAGTATGCTTCAGTCCTTGGTCTGGGT
TTGGTTAGCGAATGGTTAGCATGTTGGTTGTGGATGGTGGATTGGGCTGGCGTGGGGGTG
TGGCGATAGGATGTAGATGTGTGTATGTCTGCGTAAACTGTGAGGATAATCTGATATCGG
CGGGTAGTGATGGTCTCCTCGATTGGAGATAGAGTGTATGTAGGCTGACGTGCTTGATAT
// b=G g=T r=A y=C
CGGCGAAACGGGGCCCAAGACAGAGGGGGTAACGAAGTAAAGAGGAAGACCCAAGCCTAC
GGAAAGGTCAGCGCAGTGCAAGTGGAGCACGCGGCGACAGTAATCGATTAAGGATAGGGA
AAGGAACGTGCCAGGAACGTCAGAAGGAAGAGGCAGGAGGCAAGGGTAGGTGAGGGGGAG
AGGTGCACGGCAGACGCAGAGAGACAGATAGTGACCCTAGAGCGGCACCATAGCACATGG
TGGGACGAGCAGGATATTATGCAAGGCGCACGCGAGACAGACGGTAGCTGAGTAAGCACA
// b=G g=T r=C y=A
AGGAGCCCAGGGGAAACCGCACGCGGGGGTCCAGCCGTCCCGCGGCCGCAAACCGAATCA
GGCCCGGTACGAGACGTGACCGTGGCGACAGAGGAGCACGTCCTAGCTTCCGGCTCGGGC
CCGGCCAGTGAACGGCCAGTACGCCGGCCGCGGACGGCGGACCGGGTCGGTGCGGGGGCG
CGGTGACAGGACGCAGACGCGCGCACGCTCGTGCAAATCGCGAGGACAACTCGACACTGG
TGGGCAGCGACGGCTCTTCTGACCGGAGACAGAGCGCACGCAGGTCGATGCGTCCGACAC
// b=T g=A r=C y=G
GTTGTCCCGTTTTGGGCCTCGCTCTTTTTACCGTCCTACCCTCTTCCTCGGGCCTGGACG
TTCCCTTAGCTGTGCTATGCCTATTCTGCGTGTTGTCGCTACCAGTCAACCTTCACTTTC
CCTTCCGTATGGCTTCCGTAGCTCCTTCCTCTTGCTTCTTGCCTTTACTTATCTTTTTCT
CTTATGCGTTGCTCGTGCTCTCTCGCTCACTATCGGGACTCTGTTGCGGCACTGCGCATT
ATTTCGTCTGCTTCACAACATGCCTTGTGCGTGTCTCGCTCGTTACTGATCTACCTGCGC
// b=T g=A r=G y=C
CTTCTGGGCTTTTCCCGGTGCGTGTTTTTAGGCTGGTAGGGTGTTGGTGCCCGGTCCAGC
TTGGGTTACGTCTCGTATCGGTATTGTCGCTCTTCTGCGTAGGACTGAAGGTTGAGTTTG
GGTTGGCTATCCGTTGGCTACGTGGTTGGTGTTCGTTGTTCGGTTTAGTTATGTTTTTGT
GTTATCGCTTCGTGCTCGTGTGTGCGTGAGTATGCCCAGTGTCTTCGCCGAGTCGCGATT
ATTTGCTGTCGTTGAGAAGATCGGTTCTCGCTCTGTGCGTGCTTAGTCATGTAGGTCGCG
// b=T g=C r=A y=G
GTTGTAAAGTTTTGGGAATAGATATTTTTCAAGTAATCAAATATTAATAGGGAATGGCAG
TTAAATTCGATGTGATCTGAATCTTATGAGTGTTGTAGATCAACGTACCAATTACATTTA
AATTAAGTCTGGATTAAGTCGATAATTAATATTGATTATTGAATTTCATTCTATTTTTAT
ATTCTGAGTTGATAGTGATATATAGATACATCTAGGGCATATGTTGAGGACATGAGACTT
CTTTAGTATGATTACACCACTGAATTGTGAGTGTATAGATAGTTCATGCTATCAATGAGA
// b=T g=C r=G y=A
ATTATGGGATTTTAAAGGTGAGTGTTTTTCGGATGGTCGGGTGTTGGTGAAAGGTAACGA
TTGGGTTCAGTATAGTCTAGGTCTTGTAGATATTATGAGTCGGCATGCCGGTTGCGTTTG
GGTTGGATCTAAGTTGGATCAGTGGTTGGTGTTAGTTGTTAGGTTTCGTTCTGTTTTTGT
GTTCTAGATTAGTGATAGTGTGTGAGTGCGTCTGAAACGTGTATTAGAAGCGTAGAGCTT
CTTTGATGTAGTTGCGCCGCTAGGTTATAGATATGTGAGTGATTCGTACTGTCGGTAGAG
// b=T g=G r=A y=C
CTTCTAAACTTTTCCCAATACATATTTTTGAACTAATGAAATATTAATACCCAATCCGAC
TTAAATTGCATCTCATGTCAATGTTATCACTCTTCTACATGAAGCTAGGAATTAGATTTA
AATTAACTGTCCATTAACTGCATAATTAATATTCATTATTCAATTTGATTGTATTTTTAT
ATTGTCACTTCATACTCATATATACATAGATGTACCCGATATCTTCACCAGATCACAGTT
GTTTACTATCATTAGAGGAGTCAATTCTCACTCTATACATACTTGATCGTATGAATCACA
// b=T g=G r=C y=A
ATTATCCCATTTTAAACCTCACTCTTTTTGCCATCCTGCCCTCTTCCTCAAACCTAAGCA
TTCCCTTGACTATACTGTACCTGTTCTACATATTATCACTGCCGATCGGCCTTCGCTTTC
CCTTCCATGTAACTTCCATGACTCCTTCCTCTTACTTCTTACCTTTGCTTGTCTTTTTCT
CTTGTACATTACTCATACTCTCTCACTCGCTGTCAAAGCTCTATTACAACGCTACACGTT
GTTTCATCTACTTCGCGGCGTACCTTATACATATCTCACTCATTGCTAGTCTGCCTACAC

_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Fri Jul 20, 2007 11:26 am    Post subject: Reply with quote

You guys are amazing. I have to say it's so exciting to see you all back on a puzzle again Cool Sorry I don't have anything to contribute (Guess I should get back onto the LGpedia - at least I can do that).

I'm just sitting here watching with my jaw hanging open. This is a total blast! ('scuse the pun TOSG Wink )
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page Previous  1, 2, 3  Next
Page 2 of 3

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP