Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

Traveler J - "Catalyst (Find Him)" [02/08/2007]
Goto page 1, 2, 3 ... 9, 10, 11  Next
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Thu Feb 08, 2007 12:23 pm    Post subject: Traveler J - "Catalyst (Find Him)" [02/08/2007] Reply with quote

Here's all the info discovered so far in the latest video, titled "Catalyst (Find Him)", which can be viewed at http://www.youtube.com/watch?v=egMFKctGzoE

The description is:

Quote:

If we value the pursuit of knowledge, we must be free to follow wherever that search may lead us.


The tags are:

Quote:
Search 5'3' Restriction FacilityJ OpAphid


The following were taken from the "parcel" thread:

McPackage wrote:
In the new video, I believe the morse code is:

Code:

...-- ---.. ---.. ..-. ----. -


which translates to 388F9T


kellylen wrote:
which is a tiny url

http://tinyurl.com/388F9T

the text at the tinyurl is a code

Code:
R0dBR1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUd
BVEdHQ0dHQ0NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUN
HQ0dHR0FHVEdBR0dHR0FHQ0FHVFRHR0dDQ0FBR0FUR
0dDR0dDQ0dDQ0dBR0dHQUNDR0dUR0dHQ0dBQ0dHR0
dHQUdUR0FHR0FUQ0NUVFRUVEFUVENUVENHQUNUQ0F
HR0FUQ0NHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0N
HR0NDR0NDR0FHR0dBQ0NHR1RHR0dDR0FDR0dDR0dBR
1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUdBVEdHQ0dHQ0
NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUNHR0dHQUdUR0
FHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0NHR0NDR0N
DR0FHR0dBQ0NHR1RHR0dDR0FDR0NHR0dBR1RHDQoNC
jEoLTQpIDcoLTQpIDggMSAyIDMgOSgtMSkgNCgrMyk=




kellylen wrote:
ok I did some more research.

base64 which converts to

Code:

GGAGTGAGGGGAGCAGTTGGGCCAAGAT
GGCGGCCGCCGAGGGACCGGTGGGCGACGCGG
GAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGC
CGCCGAGGGACCGGTGGGCGACGGGGGAGTGAG
GATCCTTTTTATTCTTCGACTCAGGATCCGGGGAG
CAGTTGGGCCAAGATGGCGGCCGCCGAGGGACC
GGTGGGCGACGGCGGAGTGAGGGGAGCAGTTGG
GCCAAGATGGCGGCCGCCGAGGGACCGGTGGGC
GACGGGGAGTGAGGGGAGCAGTTGGGCCAAGATG
GCGGCCGCCGAGGGACCGGTGGGCGACGCGGGAGTG

1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)


which to me is a DNA sequence code. I'm not too sure about the numbers though
Back to top
View user's profile Send private message Visit poster's website AIM Address
blahblablee
Lonely Fan


Joined: 31 Dec 2006
Posts: 237
Location: FacilityJ

PostPosted: Thu Feb 08, 2007 2:58 pm    Post subject: Reply with quote

I think I found the key =)
http://www.maa.org/mathland/mathtrek_4_10_00.html
Back to top
View user's profile Send private message
blahblablee
Lonely Fan


Joined: 31 Dec 2006
Posts: 237
Location: FacilityJ

PostPosted: Thu Feb 08, 2007 3:04 pm    Post subject: Reply with quote

Actually nvm it some of the things aren't in that code...
Back to top
View user's profile Send private message
blahblablee
Lonely Fan


Joined: 31 Dec 2006
Posts: 237
Location: FacilityJ

PostPosted: Thu Feb 08, 2007 3:08 pm    Post subject: Reply with quote

Here's another you can try...
http://library.thinkquest.org/10679/biology/bio_rib.html

Edit to add: Another thing I found http://www.sciencenews.org/pages/sn_arch/7_20_96/mathland.htm

Edit to add: More crap
http://waynesword.palomar.edu/codons.htm
Back to top
View user's profile Send private message
blahblablee
Lonely Fan


Joined: 31 Dec 2006
Posts: 237
Location: FacilityJ

PostPosted: Thu Feb 08, 2007 4:14 pm    Post subject: Reply with quote

Um the tag says to search restriction 5'3'

Restriction enzymes...These break up DNA

This leads me to believe that the numbers represent breaks in the DNA...
Back to top
View user's profile Send private message
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Fri Feb 09, 2007 3:59 pm    Post subject: Reply with quote

One of the pages that comes up when searching for "5'3' restriction" is http://www.escience.ws/b572/L5/L5.htm . I can't figure out if that is supposed to help or not, but it does look to be related to the "Coded Rings" video (see http://www.youtube.com/watch?v=0mM6Eo0VyG8 ). Note that 2 of the tags on that video are "Decoder Ring".

Searching just for "5'3'" results in http://psyche.uthct.edu/shaun/SBlack/geneticd.html , which has a table very similar to the one used to decode the sequence in the previous puzzle. I did go ahead and decode the sequence, but I still am not clear on what the numbers are for. Here's the list, just in case it is relevant:

Code:

GGA   Glycine
GTG   Valine
AGG   Arginine
GGA   Glycine
GCA   Alanine
GTT   Valine
GGG   Glycine
CCA   Proline
AGA   Arginine
TGG   Tryptophan
CGG   Arginine
CCG   Proline
CCG   Proline
AGG   Arginine
GAC   Asparagine
CGG   Arginine
TGG   Tryptophan
GCG   Alanine
ACG   Threonine
CGG   Arginine
GAG   Aspartic acid
TGA   Ter [end]
GGG   Glycine
GAG   Aspartic acid
CAG   Glutamine
TTG   Leucine
GGC   Glycine
CAA   Glutamine
GAT   Aspartic acid
GGC   Glycine
GGC   Glycine
CGC   Arginine
CGA   Arginine
GGG   Glycine
ACC   Threonine
GGT   Glycine
GGG   Glycine
CGA   Arginine
CGG   Arginine
GGG   Glycine
AGT   Serine
GAG   Aspartic acid
GAT   Aspartic acid
CCT   Proline
TTT   Phenylalanine
TAT   Tyrosine
TCT   Serine
TCG   Serine
ACT   Threonine
CAG   Glutamine
GAT   Aspartic acid
CCG   Proline
GGG   Glycine
AGC   Serine
AGT   Serine
TGG   Tryptophan
GCC   Alanine
AAG   Lysine
ATG   Methionine
GCG   Alanine
GCC   Alanine
GCC   Alanine
GAG   Aspartic acid
GGA   Glycine
CCG   Proline
GTG   Valine
GGC   Glycine
GAC   Asparagine
GGC   Glycine
GGA   Glycine
GTG   Valine
AGG   Arginine
GGA   Glycine
GCA   Alanine
GTT   Valine
GGG   Glycine
CCA   Proline
AGA   Arginine
TGG   Tryptophan
CGG   Arginine
CCG   Proline
CCG   Proline
AGG   Arginine
GAC   Asparagine
CGG   Arginine
TGG   Tryptophan
GCG   Alanine
ACG   Threonine
GGG   Glycine
AGT   Serine
GAG   Aspartic acid
GGG   Glycine
AGC   Serine
AGT   Serine
TGG   Tryptophan
GCC   Alanine
AAG   Lysine
ATG   Methionine
GCG   Alanine
GCC   Alanine
GCC   Alanine
GAG   Aspartic acid
GGA   Glycine
CCG   Proline
GTG   Valine
GGC   Glycine
GAC   Asparagine
GCG   Alanine
GGA   Glycine
GTG   Valine
Back to top
View user's profile Send private message Visit poster's website AIM Address
janesalteredstates
Devoted Fan


Joined: 12 Jan 2007
Posts: 763
Location: Jenlight's head

PostPosted: Fri Feb 09, 2007 5:11 pm    Post subject: Reply with quote

1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)

OK I am sure everyone tried this, but I have to post it.

1(-4) = -4
7(-4) = -28
then...
8
1
2
3
9(-1) = -9
4(+3) = 12 or +12

-4 -28 8 1 2 3 -9 12

Can't hurt, right?
_________________
It takes a thousand voices to tell a single story.
http://youtube.com/profile?user=jenlight
Back to top
View user's profile Send private message Visit poster's website
Brucker
Casual Observer


Joined: 13 Oct 2006
Posts: 91

PostPosted: Fri Feb 09, 2007 6:25 pm    Post subject: Reply with quote

McPackage wrote:
I did go ahead and decode the sequence, but I still am not clear on what the numbers are for. Here's the list, just in case it is relevant:


The problem with decoding DNA is that you have to know your starting point, which is why finding the 5'3' restriction is important. You've started decoding at the beginning, but even in real-life biology, DNA codes have strings of nonsense at the end.

The link you gave names "GGATCC" as a 5'3' restriction (I don't know if it's the only one; as much as I do know about DNA, I'm not a molecular biologist, and didn't follow the article very well) and that sequence appears twice in the given sequence. If that were the sequence to look for, then you would start coding on the second guanosine, yielding:

Code:

GAT Aspartic acid
CCT Proline
TTT Phenylalanine
TAT Tyrosine
TCT Serine
TCG Serine
ACT Threonine
CAG Glutamine
GAT Aspartic acid
CCG Proline
GGG Glycine
AGC Serine
AGT Serine
TGG Tryptophan
GCC Alanine
AAG Lysine
ATG Methionine or START
GCG Alanine
GCC Alanine
GCC Alanine
GAG Glutamic acid
GGA Glycine
CCG Proline
GTG Valine
GGC Glycine
GAC Aspartic acid
GGC Glycine
GGA Glycine
GTG Valine
AGG Arginine
GGA Glycine
GCA Alanine
GTT Valine
GGG Glycine
CCA Proline
AGA Arginine
TGG Tryptophan
CGG Arginine
CCG Proline
CCG Proline
AGG Arginine
GAC Aspartic acid
CGG Arginine
TGG Tryptophan
GCG Alanine
ACG Threonine
GGG Glycine
AGT Serine
GAG Glutamic acid
GGG Glycine
AGC Serine
AGT Serine
TGG Tryptophan
GCC Alanine
AAG Lysine
ATG Methionine or START
GCG Alanine
GCC Alanine
GCC Alanine
GAG Glutamic acid
GGA Glycine
CCG Proline
GTG Valine
GGC Glycine
GAC Aspartic acid
GCG Alanine
GGA Glycine
GTG Valine

This looks like what you have actually, but starting later. Actually, the presence of those "START" codons could be important as well, but I can't make heads or tails of the numbers.
_________________
-BRUCKER

Teen1: He's cool.
Teen2: Are you being sarcastic, dude?
Teen1: I don't even know anymore.

(The Simpsons, "Homerpalooza")
Back to top
View user's profile Send private message Visit poster's website
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Sat Feb 10, 2007 6:27 pm    Post subject: Reply with quote

I just wrote Traveler to ask why McPackage had to destroy J2, and he didn't do it himself. Here is the answer I received:



So it looks like "WD" are the initials of the man we are looking for. It also looks like we must identify the right enzyme. That's pretty much out of my league - hope you biochemists can handle that one. He points to clues in the video - seems there must be some we have missed. What I find most curious is the last sentence:

"finding the enzyme is a double-edged sword if you don't realize that it can cut twice."

*runs off to rewatch the last video and see what I've missed*
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
kellylen
The Order of Denderah


Joined: 21 Nov 2006
Posts: 2823
Location: New Jersey

PostPosted: Sun Feb 11, 2007 12:43 am    Post subject: Reply with quote

oiiiiiiii enzymes.

we would have to find the sequence for the proteins and then figure out which corresponds to the enzyme

as i just woke up im not going to do it.

maybe later today.
_________________
-Kelly
Back to top
View user's profile Send private message Send e-mail
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Sun Feb 11, 2007 12:53 am    Post subject: Reply with quote

Are there special enzymes that can "cut twice"?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
kellylen
The Order of Denderah


Joined: 21 Nov 2006
Posts: 2823
Location: New Jersey

PostPosted: Sun Feb 11, 2007 2:05 am    Post subject: Reply with quote

there maybe, I'm not quite sure yet as I only have just started studying biochemistry
_________________
-Kelly
Back to top
View user's profile Send private message Send e-mail
blahblablee
Lonely Fan


Joined: 31 Dec 2006
Posts: 237
Location: FacilityJ

PostPosted: Sun Feb 11, 2007 11:16 am    Post subject: Reply with quote

Luminous wrote:
Are there special enzymes that can "cut twice"?


He's refering to the restriction enzymes:

From wikipedia:
A restriction enzyme (or restriction endonuclease) is an enzyme that cuts double-stranded DNA. The enzyme makes two incisions, one through each of the phosphate backbones of the double helix without damaging the bases.
Back to top
View user's profile Send private message
blahblablee
Lonely Fan


Joined: 31 Dec 2006
Posts: 237
Location: FacilityJ

PostPosted: Sun Feb 11, 2007 11:19 am    Post subject: Reply with quote

I don't know if this will help but:

Restriction Enzyme Finder:
http://tools.neb.com/NEBcutter2/index.php

And this site has 6 tools:
http://insilico.ehu.es/restriction/
Back to top
View user's profile Send private message
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Sun Feb 11, 2007 2:25 pm    Post subject: Reply with quote

Hey, I just stumbled upon this thread - I don't really know any of the backstory here, but I did a homology search on the DNA sequence, and it's a pretty good match with human nucleoporin (the protein complexes that allow molecules to enter and leave the cell's nucleus) DNA.

Don't know if that helps any, but there you go.

I do research in a molecular biology lab, so I'm pretty conversant with this stuff...feel free to PM me if you need.

EDIT: you guys also might want to try translating the DNA sequence into its one-letter protein codes, and see if it spells out anything. I couldn't find anything, but maybe there's a trick (Anagram? Special portion to decode?)
Back to top
View user's profile Send private message
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page 1, 2, 3 ... 9, 10, 11  Next
Page 1 of 11

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP