Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

Traveler J - "Catalyst (Find Him)" [02/08/2007]
Goto page Previous  1, 2, 3 ... 8, 9, 10, 11  Next
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Thu Feb 22, 2007 11:23 pm    Post subject: Reply with quote

Here are screen caps with the letters/symbols from the leader to the video. Without my video software, it's difficult for me to tell if they are in the right sequence, or if I got all of them. I had to catch these by the click play button / screen cap method:









and these three images janesalteredstates captured from the end:







I'm also wondering if the number of rectangles/lines at the beginning might mean something as well?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Fri Feb 23, 2007 12:45 am    Post subject: Reply with quote

The video is on revver too, which lets you download the video directly.

http://one.revver.com/watch/179933

Download and view in quicktime. You can advance frame-by-frame with the left-right arrow keys while the video is paused.
Back to top
View user's profile Send private message Visit poster's website AIM Address
McPackage
Casual Observer


Joined: 22 Jan 2007
Posts: 76
Location: California

PostPosted: Sun Feb 25, 2007 7:32 pm    Post subject: Reply with quote

Walter updated his myspace profile:

Quote:
You kids still haven't found my full name? I'm not entirely surprised. You act as if I gave you a chiffre indéchiffrable.
Back to top
View user's profile Send private message Visit poster's website AIM Address
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Sun Feb 25, 2007 8:09 pm    Post subject: Reply with quote

McPackage wrote:
Walter updated his myspace profile:

Quote:
You kids still haven't found my full name? I'm not entirely surprised. You act as if I gave you a chiffre indéchiffrable.


Laughing

Well, I'm a beginner at this stuff, and I've gone as far as I can go. (until I get me video software running and I can disect the the video frame by frame. I have another week or so to go on that. I had a malware attack that mucked up my registry. For some reason the only thing it really damaged was my video editing program.) I tried looking at it in quicktime, but it still doesn't give me the control I need to make sure I'm seeing everything that needs to be seen. I suspect there may be some counting we need to do. If that's the case, we need to see everything that is there.

I tried my hand at decoding the cyper, with no luck. I just don't know enough about what I'm doing Sad

But now that Walter is talking to us, maybe he'll give us some hints I can understand.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
theslyestfox
Casual Observer


Joined: 09 Jan 2007
Posts: 44
Location: B.C., Canada

PostPosted: Mon Feb 26, 2007 3:43 am    Post subject: Reply with quote

McPackage wrote:
Walter updated his myspace profile:

Quote:
You kids still haven't found my full name? I'm not entirely surprised. You act as if I gave you a chiffre indéchiffrable.



when i googled "chiffre indéchiffrable" i got :
http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

so it looks like Luminous was right:

Luminous wrote:
theresascraps wrote:
I am going to write down the words and try to rearrange them so i can see if they form some wort of words, but there are almost too many wierd consonants and vowels are wrong....


theresa


I agree. That's why I haven't even gone there. I'm wondering if it might be a vigenere cipher:

http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

If so, what would the key be?

Also, if it's not a vigenere cipher, I wonder what sort of code might use the numbers 11226( 8 ) as a key?


so i bet if we can make it it'll give us his last name! sadly i have little to no clue how to so such a thing....i leave it to you who do!
_________________
Let's prove science wrong for the rest of our lives!!!


http://www.youtube.com/theslyestfox
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Mon Feb 26, 2007 3:43 am    Post subject: Reply with quote

Ok, I realize this is very basic for a lot of people here, but it's a stiff learning curve for me.

From a pointer Trainer had given me, I knew the stamp on the telegram was a cipher, but with no experience, I had no idea what kind.

Walter's comment "You act as if I gave you a chiffre indéchiffrable". Lead me here:

http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

So now I know we have a vigenere cipher, but in order to crack it we need to know what the key is. I'm sure it's right in front of me, but I'm just not seeing it yet.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
theslyestfox
Casual Observer


Joined: 09 Jan 2007
Posts: 44
Location: B.C., Canada

PostPosted: Mon Feb 26, 2007 3:45 am    Post subject: Reply with quote

Luminous wrote:
Ok, I realize this is very basic for a lot of people here, but it's a stiff learning curve for me.

From a pointer Trainer had given me, I knew the stamp on the telegram was a cipher, but with no experience, I had no idea what kind.

Walter's comment "You act as if I gave you a chiffre indéchiffrable". Lead me here:

http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher

So now I know we have a vigenere cipher, but in order to crack it we need to know what the key is. I'm sure it's right in front of me, but I'm just not seeing it yet.


*laughs* we posted at almost exactly the same time!!! Laughing
_________________
Let's prove science wrong for the rest of our lives!!!


http://www.youtube.com/theslyestfox
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Mon Feb 26, 2007 3:53 am    Post subject: Reply with quote

I noticed that Laughing Any ideas on what the key word might be? I'm thinking of trying walter

edit: Here is a tool Trainer101 pointed me to for decoding cyphers. I have been playing with it, but no luck yet Rolling Eyes

http://rumkin.com/tools/cipher/
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
theresascraps
Lonely Fan


Joined: 14 Feb 2007
Posts: 178
Location: arizona

PostPosted: Mon Feb 26, 2007 9:55 am    Post subject: Reply with quote

Well there could be so many keywords here....I mean, DNA, RNA, embryo, research, genes...All could be possiblities. I agree about the learning curve. I am working on learning it myself....i think you are right thought, i think this jumble of letters will give us a last name...

theresa
Back to top
View user's profile Send private message Yahoo Messenger
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Mon Feb 26, 2007 2:31 pm    Post subject: Reply with quote

I tried walter, and it didn't work, but then again I don't know what I'm doing. I'm using the rumkin cipher tool, but there are so many possibilities, I'm not sure where to start. I tried using the first 27 letters of the DNA sequence, since there are 27 letters in the cipher. I also tried using the inverse and the complement, of 27 letters from both ends of the sequence, since Walter said we have to "shift our perspective on the sequence that got us here" I have a hunch the key is in something we have decoded. I wish I knew more about what I'm looking for and how to use it when I find it Confused

The rumkin cipher tool offers three options for deciphering a viginere cypher:

1.) The standard vigener cipher, which asks only for a pass phrase. I'm not sure what makes up a good pass phrase. I think it can be any length, although it must repeat to equal the number of letters in the phrase you are deciphering.

2.) Then there is a keyed vigener cipher which asks for an alphabet key in addition to a passphrase. I'm not sure what the difference is between a key and a passphrase, how they work and how to know the difference when you are trying to find them.

3.) It also as an Autokeyed option that wants a passphrase. I have know idea what that means or how it's different than the other two. It seems that maybe it's a tool used for encryption rather than decryption, yet is has a decrypt option Confused

There are so many variations on vigener ciphers and their potential keys and passphrases it makes my head swim.

I know walter has given us what we need. There has to be a smart, easy way to solve this.

Hmmmmmm. Still thinking. Think
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Mon Feb 26, 2007 9:52 pm    Post subject: Reply with quote

I tried a few things, but couldn't make any headway. Perhaps we should solicit some help from people in the OpAphid section; they seem to be brilliant at figuring out these sorts of things.
Back to top
View user's profile Send private message
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Mon Feb 26, 2007 10:36 pm    Post subject: Reply with quote

I wish they would help, but I think they might be taking some sadistic pleasure in watching us thrash around with this Twisted Evil I'm sure any number of them could solve this in seconds.

In the mean time, I keep referring back to Walter's note.



Especially the part that reads THE SECOND ENZYME WAS MORE SIGNIFICANT | I SUPPOSE IT IS TIME THAT I LET YOU KNOW MY FULL IDENTITY | TO FIND IT YOU WILL HAVE TO SHIFT YOUR PERSPECTIVE ON THE SEQUENCE THAT GOT YOU HERE

I can't help but think that these are somehow the keys to the cypher. When you play around with the DNA sequence is there a frame shift, that involves the Taqi enzyme that would give us a that is 27 letters long or shorter? Any thing that looks like it might be a passphrase for the cipher? I'm grasping at straws here, but for now it's the best I can do.

By the way, thanks for the message explaining what a frame shift is. It's helping me form my thinking around solving this puzzle. I also remember at one time you said the STOP's might be important as well, maybe somehow referencing stop codon's?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Mon Feb 26, 2007 10:50 pm    Post subject: Reply with quote

Luminous wrote:
When you play around with the DNA sequence is there a frame shift, that involves the Taqi enzyme that would give us a that is 27 letters long or shorter? Any thing that looks like it might be a passphrase for the cipher? I'm grasping at straws here, but for now it's the best I can do.


Nothing that I can think of, sorry.

Luminous wrote:
By the way, thanks for the message explaining what a frame shift is. It's helping me form my thinking around solving this puzzle. I also remember at one time you said the STOP's might be important as well, maybe somehow referencing stop codon's?


Yep, that was my thought, although I'm not sure if it pans out at all.
Back to top
View user's profile Send private message
Luminous
Thor's Hammer


Joined: 26 Nov 2006
Posts: 1359
Location: Facility J

PostPosted: Tue Feb 27, 2007 12:13 am    Post subject: Reply with quote

Something I Found on Wikipedia that I think might be pertinent:

Frameshift mutation

A frameshift mutation (also called a frameshift or a framing error) is a genetic mutation that inserts or deletes a number of nucleotides that is not evenly divisible by three from a DNA sequence. Due to the triplet nature of gene expression by codons, the insertion or deletion can disrupt the reading frame, or the grouping of the codons, resulting in a completely different translation from the original. The earlier in the sequence the deletion or insertion occurs, the more altered the protein produced is.

A frameshift mutation causes the reading of codons to be different, so all codons after the mutation (with a few exceptions due to redundancy) will code for different amino acids. Furthermore, the stop codon "UAA, UGA, or UAG" will not be read, or a stop codon could be created at an earlier site. The protein being created could be abnormally short, (maybe 27 letters or shorter?) abnormally long, and/or contain the wrong amino acids. It will most likely not be functional.

EDIT: The more I contemplate this the more it makes sense to me that this is what we are looking for. I think we have to rework the DNA sequence before the cipher can be cracked.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Back to top
View user's profile Send private message Visit poster's website
Weepel
Suspiciously Absent


Joined: 30 Jan 2007
Posts: 16

PostPosted: Tue Feb 27, 2007 1:11 pm    Post subject: Reply with quote

Luminous wrote:
TO FIND IT YOU WILL HAVE TO SHIFT YOUR PERSPECTIVE ON THE SEQUENCE THAT GOT YOU HERE

It seems to me that the idea ist o take the DNA sequence that was decoded and then use that as a new coded message in a vigenere cipher (which is just a bunch of shifts http://en.wikipedia.org/wiki/Vigen%C3%A8re_cipher). I think its just a matter of finding the key and applying it to: cgacatatgagcatggcgaccagcaccttcagtgcgcagtgtggcccggagcatcattacctggctgaa
cattcttctatttttaatggcgtcttcagccagcagcttaaaaacaaccttatctactttccctcctcctactttccctcctcccgcttgagggtaggccccatcccccccttt
Back to top
View user's profile Send private message
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page Previous  1, 2, 3 ... 8, 9, 10, 11  Next
Page 9 of 11

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP