Lonelygirl15

[deagol]

Sorry I wasn't clear about the table. This is how it works: you have a letter [a t g c] and you want to vigenere it into another (or even the same) letter of the same set [a t g c]. The table gives you the 4*4 possible keys for doing that. All those a's are just the key you would use to keep the letter unchanged, because any letter ciphered with 'a' as a key isn't shifted at all. In other words, a=0 regarding the key shift.

For example, the first letter that doesn't decode from the original sequence is the 28th (t). So, you would look in the table the row that ciphers into 't' (2nd row) to find the possible keys that would code a valid DNA character, the possible keys are [t a n r] and that 't' would decript into [a t g c] respectively.

Ok I just realized you don't need to try every combination to complete the key, just padding it with x's or z's would show you when it's the proper length to make it all happen, and I'm sorry to say I tried quite a few lengths but none worked. I also realized that there could be an extra letter in the key, but tried removing quite a few and still doesn't look like it's working, eventhough some parts do fall into a valid DNA sequence.

I think the stamp may have been separated into words like that for a reason. Maybe the key does not repeat like in a vigenere cipher, but it keeps changing (based on those words) like in a one-time pad. This idea fits well with what Walter said about an chiffre indéchiffrable: that is precisely what a one-time pad is... that is, of course, if you don't know anything about the key.

[TOSG]

This is kind of interesting, although I'm not sure that it's the answer we're looking for.

If you decode the DNA sequence that I found in the previous puzzle in the 3' ---> 5' direction (rather than 5'--->3'), then reverse the protein sequence, the first five amino acids spell out "SMILE" when decoded with "11228."

Maybe it's coincidence, but perhaps one of you Myspacers should try submitting that as his last name.

[Luminous]

Too bad. I tried it and it didn't work. If it had it would have totally shifted my opinion on him. Oh, well. No such luck.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

[TOSG]

Try "Dabrowski."

I'll explain if it works

[Luminous]

TOSG you are a genius! He accepted it

_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

[TOSG]

Haha, glad we finally solved it. I can't claim to being most of the brains behind this one, and I'm pretty dismayed that I didn't see this earlier.

Here goes:

Deagol (Or perhaps someone else, earlier. Props to whoever it was.) pointed out that when you use the code on Walter's "stamp" to decode the DNA sequence that I solved for the previous puzzle, the first 25 or so letters are also DNA code. Obviously, this could not be due to mere chance.

So, I looked at this sequence. It was only 26 letters long. I thought that it would be nice to have a 27-letter sequence, as this is a multiple of three, and the same length as the code in the stamp. I noticed that if you only use the first 26 letters of the code on the stamp, you get 27 (actually 2 letters of DNA code.

So, I put this DNA sequence into a protein translator. Then, I used the first nine numbers of the decoding sequence for the previous puzzle, and voila - The Big "Dabrowski" appears.

For the curious:

The DNA sequence: gttgccctgatcctgagctttttcgcgg
The protein sequence: V A L I L S F F A

[TOSG]

So, what's on the myspace, by the way?

[trainer101]

Beautiful! Amazing collaboration!
The puzzles get more and more complex - wonder what the next one will bring?
More importantly, I wonder where this is going...
_________________
It's STILL all connected...

[Luminous]

A big standing ovation to everyone who helped on this one! I'll go back and gather all the names and try to not miss any!

I went to Walters MySpace and input Dabrowski as his last name in my friend request, and, as I have already mentioned, it worked.
So now we wait to see if he is willing to accept it, but of course he is, he has already said as much in his emails.

He has to accept. We are his only hope. (help me obe wan kenobi - no, lets not go there )

He is, however, a pretty old cranky dude, so this could take awhile. (Is there a foot tapping smiley? I couldn't find one.) Anyway, we made him wait, and he doesn't move that fast, even when he's in a hurry so . . . . . . . . . . . .

For anyone who wants to add Walter as a friend, here's the URL

http://myspace.com/walterdw

Last Name: DABROWSKI

( sorry for shouting so loud, I'm just so excited )
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

[Luminous]

[Luminous]

Here is the list of everyone who contributed to discovering the true identity of Walter Dabrowski, of Facility J.

In order of appearance:

McPackage
Blahblablee
janesalteredstates
Brucker
Luminous
kellylen
TOSG
Trainer101
Weepel
Sonieee
theresascraps
autumneternal
theslyestfox
kayokosaiki
Mellie3204
deagol

Good work all!
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

[trainer101]

Luminous, did you get your editing software cranked back up? I'd love to see the "step by step" in video.
_________________
It's STILL all connected...

[theslyestfox]

[janesalteredstates]

TOSG you are a frigging genius!


Luminous hahah thanks for adding me to the list, although I wasn't all that helpful.


YAY!

... off to myspace
_________________
“It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight

[Luminous]