Lonelygirl15 Forum Index Lonelygirl15
Forum to post messages about Bree and Danielbeast
 
 FAQFAQ   SearchSearch   MemberlistMemberlist   UsergroupsUsergroups   RegisterRegister 
 ProfileProfile   Log in to check your private messagesLog in to check your private messages   Log inLog in 

TravelerJ19 - "Catalyst (You Rang?)" [03/27/2007]
Goto page Previous  1, 2, 3, 4, 5, 6, 7, 8, 9  Next
 
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive
View previous topic :: View next topic  
Author Message
Loki
Lonely Fan


Joined: 25 Sep 2006
Posts: 143
Location: Right behind you...

PostPosted: Wed Mar 28, 2007 8:51 am    Post subject: Reply with quote

Maybe we're supposed to drop the repeating letters and decode what's left?

So RORKRKRCRRRK would become OKKCRK... I think...
_________________
A trickster god with a modern twist.

Everything is not as it first appears.

Knowledge is power. Knowledge shared is power lost. -- Aleister Crowley
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Mar 28, 2007 10:48 am    Post subject: Reply with quote

Using this:
Code:
6(-3) 6(-1) 6(-3) 12(-8) 6(-3) 12(-8) 6(-3) 12(-0) 6(-3) 6(-2) 6(-3) 12(-8)
Isoleucine_Proline_Isoleucine_IsoleucineIs_Isoleucine...Aspartic_acid_Isoleucine_IsoleucineIso
     ^          ^       ^                ^      ^    ...     ^             ^                ^
     6          6       6                12     6    ...     6             6                12
UNUSUSUCUTUS
RMRKRKRCRRRK

Or using the alternative shifts:
6(-6) 6(-1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
UNUSUSUCUTUS
OMOOOOOCOOOO

I thought those O's were weird, but with Trav's recent fix that M turns into another O!

So I started playing with ceasar ciphers, and eventually plugged RORKRKRCRRRK as the message and OOOOOOOCOOOO as the key (fixed the second letter as per Trav's correction), chose decrypt, and out came:

DADWDWDADDDW

Could it be that WalterDW is TravelerJ19's dad? I'm waiting for his confirmation.
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
TOSG
Devoted Fan


Joined: 14 Sep 2006
Posts: 651

PostPosted: Wed Mar 28, 2007 11:56 am    Post subject: Reply with quote

Interesting.

And, at least we know that the shifts are correct now.
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Mar 28, 2007 12:31 pm    Post subject: Reply with quote

TOSG wrote:
Interesting.

And, at least we know that the shifts are correct now.

The thing is, that result uses both shifts. In fact, his "fix" for the second letter doesn't affect the result! It only makes it more odd because another O gets decoded, but actually any other DNA sequence, with whatever choice of numbers to pick letters (the 6's and 12's), would result in 2 alternative codes that when decrypted against each other you'd get DADWDW (there seems to be a glitch in the antepenultimate letter). This is because those operations are the equivalent of taking the difference in the alternative (a b c d) responses and converting what you get through a=0, b=1, etc.

Code:
3  1  3  8  3  8  3  0  3  2  3  8 (track numbers as they appear in the lyrics file)
6  1  6  4  6  4  6  0  6  5  6  4 (track numbers as they appear in the MP3 files )
3  0  3 -4  3 -4  3  0  3  3  3 -4 (difference)
d  a  d  w  d  w  d  a  d  d  d  w (a=0, d=3, w=-4)

This makes me think the DadWDW may be a fluke.
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Mar 28, 2007 12:59 pm    Post subject: Reply with quote

I'm tired of taking screencaps...

Quote:
From: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Subject: Re: Re: 6 and 12
Message:
That is an interesting result, but not what I'm going for. That first gibberish you sent me means nothing. Stick with your O's. Maybe you'll see something that looks out of place.

DeagolTheStoor wrote:

> Well I got the impression your previous message was confirming those shifts instead of the mp3 ones.
> So, I used one result as a key to decode the other, and got this:
>
> DADWDWDADDDW
>
> Are you saying Walter is your dad?
>

So, back to square 1, I guess.
Code:
6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
 U  N  U  S  U  S  U  C  U  T  U  S
-6 +1 -6 -4 -6 -4 -6 -0 -6 -5 -6 -4
 O  O  O  O  O  O  O  C  O  O  O  O

What looks out of place is that C (it came from the 12th letter in OchreOchreOchre). In order to fix it, it would have to be an O. Maybe it should've been the 11th letter, or the 6th, or the 1st. Or I could keep the 12th letter C, but change that odd (-0) shift, where I would need a (+12) to get an O. Or perhaps I should've used Stop and it'd be the 3rd, 7th, or 11th letter. Or if I kept the 12th letter, a P, It'd require a (-1) shift. Or maybe he just wants me to fix that codon so an O comes out? Even then, I don't know what's the point of getting all O's. I think this puzzle sucks. Laughing
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Wed Mar 28, 2007 1:11 pm    Post subject: Reply with quote

deagol wrote:
I'm tired of taking screencaps...

Quote:
From: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Subject: Re: Re: 6 and 12
Message:
That is an interesting result, but not what I'm going for. That first gibberish you sent me means nothing. Stick with your O's. Maybe you'll see something that looks out of place.

DeagolTheStoor wrote:

> Well I got the impression your previous message was confirming those shifts instead of the mp3 ones.
> So, I used one result as a key to decode the other, and got this:
>
> DADWDWDADDDW
>
> Are you saying Walter is your dad?
>

So, back to square 1, I guess.
Code:
6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
 U  N  U  S  U  S  U  C  U  T  U  S
-6 +1 -6 -4 -6 -4 -6 -0 -6 -5 -6 -4
 O  O  O  O  O  O  O  C  O  O  O  O

What looks out of place is that C (it came from the 12th letter in OchreOchreOchre). In order to fix it, it would have to be an O. Maybe it should've been the 11th letter, or the 6th, or the 1st. Or I could keep the 12th letter C, but change that odd (-0) shift, where I would need a (+12) to get an O. Or perhaps I should've used Stop and it'd be the 3rd, 7th, or 11th letter. Or if I kept the 12th letter, a P, It'd require a (-1) shift. Or maybe he just wants me to fix that codon so an O comes out? Even then, I don't know what's the point of getting all O's. I think this puzzle sucks. Laughing

Using "StopOchre" gets the desired "OOOOOOOOOOOO" result.
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Mar 28, 2007 1:22 pm    Post subject: Reply with quote

Ahh good catch mouse. But what's the point?

O=117=aag=K=Lysine?
12 o's?
cheeri-o's ???
naught.

I still think it sucks.
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Wed Mar 28, 2007 1:43 pm    Post subject: Reply with quote

Clock?
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Mar 28, 2007 5:08 pm    Post subject: Reply with quote

Well, I'm pretty much done with this for now. Here's the latest message I sent to Trav:

Quote:
To: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Read: —
Subject: Re: Re: Re: Re: Re: 6 and 12
Message:
Ok, so I've been working with ALL those decoding numbers remapped to the MP3 files track numbers, including the 6 and 12. Track 6 is #7 in the MP3, and track 12 is #3. This gives me the following decoding numbers:
7(-6) 7(+1) 7(-6) 3(-4) 7(-6) 3(-4) 7(-6) 3(-0) 7(-6) 7(-5) 7(-6) 3(-4)

Reapplying it to the aminoacid chain, I get:
CECOCOCoCICO which shifts into WFWKWKWoWDWK

I'm using a lower case 'o' for that StopOchre which I'm not sure I'm doing right. I still don't see anything meaningful, so then I tried reading that as a new amino chain, and ran it through BOTH decoding sets of numbers (just in case).

Using the remapped numbers 7(-6) 7(+1) 7(-6) 3(-4) 7(-6) 3(-4) 7(-6) 3(-0) 7(-6) 7(-5) 7(-6) 3(-4) I get PAPSPSPoPIPS which shifts into JBJOJOJoJDJO.

Using the original numbers 6(-3) 6(+1) 6(-3) 12(-8 ) 6(-3) 12(-8 ) 6(-3) 12(-0) 6(-3) 6(-2) 6(-3) 12(-8 ) I get OLOEOEOoOTOE which shifts into LMLWLWLoLRLW.

I even tried the numbers that got me all O's before (6 and 12 but with MP3 shifts), and OLOEOEOoOTOE shifted into IMIAIAIoIOIA. To be thorough, I thought why not do the last possible combination, 7 and 3 with lyrics shifts. This shifted PAPSPSPoPIPS into MBMKMKMoMGMK.

Sorry, but I'm about to give up on this. I can't even take care of what Walter left you since I'm not in the US. I'm just trying to help some friends. Hopefully they'll be able to pick up from where I left.


TravelerJ19 wrote:

> You're right, that C does look wrong. Something else I gave you doesn't seem to make sense, either.
> Maybe you can fix both of these.
>
> > DeagolTheStoor wrote:
> >
> > Ah well alright... although it would fit the way that Walter talks about you if he were your father, haha.
> >
> > So, what's out of place is that C, which came from that "stop" codon, which I interpreted as Ochre (Walter
> > used it in a previous message). I had to pick the 12th letter in OchreOchreOchre (from your Looperama
> > hint). So, how do I fix it? Should I make it an O? and if so, what then? I get all O's, so? That still leads me
> > nowhere.
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Wed Mar 28, 2007 6:19 pm    Post subject: Reply with quote

And just in case OOOOOOOOOOOO turns out to be it (you never know, stranger things have happened...) I sent:
ignatzmouse15 wrote:
Hi Traveler,

Deagol appears to be taking a little R&R right now, so I thought I'd fill you in on our current progress.

Using the shifts:

6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)

and applying them to the amino acids:

Isoleucine
Proline
Isoleucine
IsoleucineIsoleucine
Isoleucine
IsoleucineIsoleucine
Isoleucine
StopOchreStopOchre
Isoleucine
AsparticAcid
Isoleucine
IsoleucineIsoleucine

gets us:

OOOOOOOOOOOO

Very Scooby Doo. If this is a clue for a word, I'd guess "(12 O) Clock". Better would be a Jeapordy question "What time is it?"

Is this

a) Bingo!
b) Nearly there.
c) I wouldn't start from here if I were you.

Please pass on my regards to Walter.

Pip pip,

I.M.
I'm expecting to get the answer (b). Note the sneaky Tachy reference, looking to see if TJ19 is au fait with the Plucky Underdog Resistance. Oh, and the gratiutious Ealing Comedy sign-off for good measure.

ETA: TJ19 has read his YouTube mail.
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Wed Mar 28, 2007 7:21 pm    Post subject: Reply with quote

And a very prompt reply:
TravelerJ19 wrote:
I'm not as good as Walter at numbers, but when I count 12 into Ochre, I get "C." I'd say that's also a good answer to your question. A better question would be, "Why isn't the last 'O' with his friends, and who did he get to replace him?" You have all you need in the letters you've decoded and the numbers you used to get there.

ignatzmouse15 wrote:

> Hi Traveler,
>
> Deagol appears to be taking a little R&R right now, so I thought I'd f...

So the OOOOOOOCOOOO is deliberate, and it's Ochre, not StopOchre (OK, that was a bit of a straw-clutch). O to C is a -12 shift, hmm another 12.
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
ShardinsKitten
Devoted Fan


Joined: 28 Jan 2007
Posts: 934

PostPosted: Wed Mar 28, 2007 7:54 pm    Post subject: Reply with quote

how about coo coo? (did I even spell that right?) I'm completely stumped with this one. I mean what are we supposed to do with a bunch of o's and 1 c. poor lonely c. That's wasn't very nice of him.

Quote:
Why isn't the last 'O' with his friends, and who did he get to replace him?

Could this maybe be a movie or book reference or something? like could we get the answer from a movie or book? (ok maybe that is a stretch but I guess you never know).

There's got to be a clue in that question though... I just can't figure it out.
Back to top
View user's profile Send private message Yahoo Messenger
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Mar 28, 2007 8:02 pm    Post subject: Reply with quote

He also told me all the decoding numbers are right the way we have them. So I'm guessing the only thing left to try is the DNA.

I found that the only way to get an O from the 12th character is in Tyrosine (Y), which can come from TAC or TAT codons. The original Ochre was TAA.

So, change that A for a C or a T... ACT? the original DNA would become ATTCCTATCATTATAATCATATACATTGATATCATA or ATTCCTATCATTATAATCATATATATTGATATCATA.

And I'm stuck again. Oh and thanks mouse, for taking over so efficiently. Smile
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
ignatzmouse
Enthusiastic Fan


Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ

PostPosted: Wed Mar 28, 2007 8:50 pm    Post subject: Reply with quote

deagol wrote:
He also told me all the decoding numbers are right the way we have them. So I'm guessing the only thing left to try is the DNA.

I found that the only way to get an O from the 12th character is in Tyrosine (Y), which can come from TAC or TAT codons. The original Ochre was TAA.

So, change that A for a C or a T... ACT? the original DNA would become ATTCCTATCATTATAATCATATACATTGATATCATA or ATTCCTATCATTATAATCATATATATTGATATCATA.

And I'm stuck again. Oh and thanks mouse, for taking over so efficiently. Smile

That was a short vacation Smile

You can also get O by replacing 12(0) by 6(0). Not that this helps, as doing this across the board just produces gibberish Os and Qs.

You can get O by replacing 12(0) by 12(12), so adding the first part of the index to the second gives:
Code:
6(0) 6(7) 6(0) 12(8) 6(0) 12(8) 6(0) 12(12) 6(0) 6(1) 6(0) 12(8)

with result:
Code:
UUUAUAUOUUUA

which (subbing the C back for the O) is:
Code:
UUUAUAUCUUUA

which is RNA. Applying:
Code:
12(-4) 12(-4) 12(-0) 12(-4)

gets, oh what a surprise, gibberish:
Code:
JOEE

OK, time to call it a night...

-- Efficiency Mouse
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure?
Back to top
View user's profile Send private message
deagol
Thor's Hammer


Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.

PostPosted: Wed Mar 28, 2007 9:04 pm    Post subject: Reply with quote

ignatzmouse wrote:

You can get O by replacing 12(0) by 12(12), so adding the first part of the index to the second gives:
Code:
6(0) 6(7) 6(0) 12(8) 6(0) 12(8) 6(0) 12(12) 6(0) 6(1) 6(0) 12(8)


You lost me on that one. What parts are you adding together?

Edit: oh ok I see what you did now, although I don't see why you did it. Is it just to get 12(12)?
Back to top
View user's profile Send private message Visit poster's website MSN Messenger
Display posts from previous:   
Post new topic   Reply to topic    Lonelygirl15 Forum Index -> Facility J: Archive All times are GMT - 6 Hours
Goto page Previous  1, 2, 3, 4, 5, 6, 7, 8, 9  Next
Page 4 of 9

 
Jump to:  
You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum


Powered by phpBB © 2001, 2005 phpBB Group
Protected by Anti-Spam ACP