| View previous topic :: View next topic |
| Author |
Message |
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
 Posted: Thu May 10, 2007 7:45 pm Post subject: |
 |
|
| deagol wrote: | | Luminous wrote: | | deagol wrote: | | It's pretty simple, though tedious: pick one of the four letters for each column in the table, making up something meaningful. |
Geez! That's worse than an anagram! Do you really think that will get us anywhere? |
Right. I don't know. This is kind of what imouse has been trying the last couple of days. Check my edit just in case. |
This seems pretty arbitrary to me. Am I wrong? And how will we know if we have found the right answer - it seems like there are lots of possibilities.
ETA: You guys answered my question while I was asking it lol
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
 |
deagol
Thor's Hammer
Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.
|
| Posted: Thu May 10, 2007 7:56 pm Post subject: |
|
|
| Luminous wrote: | ... it seems like there are lots of possibilities.
|
Actually, there are very few possibilities, given the sections I highlighted. Only a tinyurl code or something non-english like that would fit that part. I was thinking we would know if it's right just by doing it and reading what resulted from it, something relevant or meaningful, maybe a quote from Crowley, who knows. But it doesn't seem to work.
As someone said before, at least we're verifying what this is NOT. It's not a DNA sequence if we expect either using ijoopy as the key and a plaintext in english (my attempts) nor ijoopy as the ciphertext and the key in english (imouse's work).
Last edited by deagol on Thu May 10, 2007 8:05 pm; edited 1 time in total |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Thu May 10, 2007 8:05 pm Post subject: |
|
|
| deagol wrote: |
stool (accca)
stoor (acccg) ha, though I doubt he'd be referencing me like that.
UK mole (ctacac)
UK Monica (ctaccgca) hey maybe Bill is involved 
UK more (ctacgc)
UK Moria (ctacgga) another Tolkien reference 
UK moric (ctacggc) as in moric acid
UK MSN (ctagc)
UK of reach (ctctgcaca)
UK of leg (ctctacg)
UK of let (ctctact)
UK of neat (ctctccat)
UK of net (ctctcct)
UK of Reagan (ctctgcagtg)
UK sole (ctgcac)
UK son (ctgcc)
UK sore (ctgcgc)
UK SS reach (ctgggcaca) not sure if MI6 (Security Service) is or was ever known as the UK SS. I know MI5 is known as SIS (Secret Intelligence Service).
UK FM reach (cttagcaca)
UK FM net (cttacct)
UK folic (cttcagc) as in folic acid
UK for (cttcg) I didn't look deeper on this one as this branch seemed quite foliaged
UK foe (cttct) idem
YT (gc) as in a YouTube account, with any of the words shown above for UK, or even more since it can be a proper name. Didn't check further.
|
This looks like a lot of possibilities, especially when I consider the decrypting is only partially done - that there is more to do.
And because some of these seem at least peripherally related it's confusing to me whether there is an answer here or not - I'm just considering - what an answer would look like, and how we will know when we've found it?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
deagol
Thor's Hammer
Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.
|
| Posted: Thu May 10, 2007 8:12 pm Post subject: |
|
|
| Luminous wrote: | [long list removed]
... a lot of possibilities, especially when I consider the decrypting is only partially done - that there is more to do.
And because some of these seem at least peripherally related it's confusing to me whether there is an answer here or not - I'm just considering - what an answer would look like, and how we will know when we've found it? |
Yes Lum, I was taking an exhaustive approach starting from the beggining of the string of letters where I could read all kinds of english. Then I realized I should have inspected the whole table summarily, and save myself a lot of work by noticing the impossible combos around the middle of the string. That's where any search would break down. In that list I never went further than 10 letters into the string. |
|
| Back to top |
|
|
ignatzmouse
Enthusiastic Fan
Joined: 26 Feb 2007
Posts: 305
Location: Coconino County, AZ
|
| Posted: Thu May 10, 2007 8:26 pm Post subject: |
|
|
Trying the shifting trick on deagol's block:
| Code: | a:srmmlcaahhbzkqslcwjuurka
c:utooneccjjdbmsuneylwwtmc
g:yxssriggnnhfqwyricpaaxqg
t:lkffevttaausdjlevpcnnkdt |
produces the amusing match:
| Code: | a:srmmlcaahhbzkqslcwjuurka
c:utooneccjjdbmsuneylwwtmc
g:yxssriggnnhfqwyricpaaxqg
t:lkffevttaausdjlevpcnnkdt
a:srmmlcaahhbzkqslcwjuurka
c:utooneccjjdbmsuneylwwtmc
g:yxssriggnnhfqwyricpaaxqg
t:lkffevttaausdjlevpcnnkdt
sksseeccaa--- |
and indeed the encryption key "sksseeccaab" produces the output "atggtcccttatacatcgtggkik". But I doubt this is our secret star.
Everything else is even more gibberish.
_________________
Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Thu May 10, 2007 8:38 pm Post subject: |
|
|
Have you tried the number sequence on it iMouse?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
deagol
Thor's Hammer
Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.
|
| Posted: Thu May 10, 2007 8:58 pm Post subject: |
|
|
| ignatzmouse wrote: | ...
and indeed the encryption key "sksseeccaab" produces the output "atggtcccttatacatcgtggkik". |
This seems to be a refinement of your previous result. Take the negative mod 26 of that key (paste it in the key, type a bunch of a's in the message, and choose decrypt), and you'll see the similarity. Clearly my tables are the inverse function of yours, or the negative, or something like that, I think. There also seems to be some wiggle room...
| Code: | aaaaaaaaaaa
- sksseeccaab
= iqiiwwyyaaz
~ gboipwyyra
|
|
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Thu May 10, 2007 9:07 pm Post subject: |
|
|
Ok, so I applied the decryption sequence, I think I got this right -
DNA = Atg gtc cct tat aca tcg tgg kik
RNA = M V P Y T S W
Apply the decryption string:
4(+13) 1(+4) 8(+17) 4(-11) 1(-14) 8(-16)
M Methionine 4(+13)
V Valine 1(+4)
P Proline 8(+17)
Y Tyrosine 4(-11)
T Threonine 1(-14)
S Serine 8(-16)
Result = UZQDFJ
To me this one makes more sense because Methionine is a stop codon (See Tosg, I learned something - oops I meant start  )
V Valine 4(+13)
P Proline 1(+4)
Y Tyrosine 8(+17)
T Threonine 4(-11)
S Serine 1(-14)
W Tryptophan 8(-16)
Result = VTVTER
Still doesn't make any sense, but somehow, it feels like you guys are getting warm.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess
Last edited by Luminous on Thu May 10, 2007 9:23 pm; edited 1 time in total |
|
| Back to top |
|
|
deagol
Thor's Hammer
Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.
|
| Posted: Thu May 10, 2007 9:13 pm Post subject: |
|
|
atggtcccttatacatcgtgg
Met V P Y T S W
Methionine (start)
Valine
Proline
Tyrosine
Threonine
Serine
Tryptophan
4(+13) 1(+4) 8(+17) 4(-11) 1(-14) 8(-16)
UZQDFJ if I include the Met for the first shift, ignoring the last (Tryptophan).
VTVTER if I skip the Met (start), and use Valine for te first shift.
VTVTER sounds a little bit more promising... |
|
| Back to top |
|
|
deagol
Thor's Hammer
Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.
|
| Posted: Thu May 10, 2007 9:15 pm Post subject: |
|
|
Jinx!
 |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Thu May 10, 2007 9:21 pm Post subject: |
|
|
| deagol wrote: | Jinx!
|
 It's rare that I beat you to the draw!
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
Luminous
Thor's Hammer
Joined: 26 Nov 2006
Posts: 1359
Location: Facility J
|
| Posted: Thu May 10, 2007 10:41 pm Post subject: |
|
|
I've been thinking about this - I wish I understood better what you guys are doing to decode this, but here's something I noticed
ATG = M - Start codon - so that makes sense.
GTC = V
CCT = P
TAT = Y
ACA = T
TCG = S
TGG = W
KIK = ?
When translated this gives us VTVTER, which still looks like nonsense to me, I have no clue how we would apply it or what we would apply it to.
So there are two things I'm contemplating -
1. What would it take to turn KIK into a stop codon to balance the ATG start codon, and how would that affect the rest of the sequence?
2. is KIK an IKYOIK kind of thing, and if so, how would that affect the rest of the sequence?
This may not make any sense at all.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
|
deagol
Thor's Hammer
Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.
|
| Posted: Thu May 10, 2007 11:27 pm Post subject: |
|
|
Here's what I was saying about the wiggle room:
| Code: | a:srm mlc aah hbz kqs lcw juu rka
c:uto one ccj jdb msu ney lww tmc
g:yxs sri ggn nhf qwy ric paa xqg
t:lkf fev tta aus djl evp cnn kdt
a:s rmm lca ahh bzk qslcwjuurka
c:u too nec cjj dbm suneylwwtmc
g:y xss rig gnn hfq wyricpaaxqg
t:l kff evt taa usd jlevpcnnkdt
sks s** cca a*s kss **c caa ***
n n nn
ijo opy aat tzb qki pye rgg jqa
atg g** ccg g*t aca **g ttt ***
cct t*t ttg
tgt
tgg
Met Val Pro Val Thr *** Phe
Ala Ala Leu
Asp Asp Cys
Glu Gly Trp
Gly Phe
Ser
Tyr
Cys
skip ? T ? T ? ?
|
If anyone understands this, can you fill-in the question marks? Ignatz?
Last edited by deagol on Fri May 11, 2007 12:46 am; edited 3 times in total |
|
| Back to top |
|
|
TOSG
Devoted Fan
Joined: 14 Sep 2006
Posts: 651
|
| Posted: Fri May 11, 2007 12:23 am Post subject: |
|
|
| I've got no new insights as of right now (it still feels like we haven't been given a critical piece of the puzzle), but I just wanted to note that you guys are all brilliant! |
|
| Back to top |
|
|
deagol
Thor's Hammer
Joined: 28 Oct 2006
Posts: 1068
Location: No, not here.
|
| Posted: Fri May 11, 2007 12:55 am Post subject: |
|
|
| Luminous wrote: | ...
KIK = ?
When translated this gives us VTVTER, which still looks like nonsense to me, I have no clue how we would apply it or what we would apply it to.
So there are two things I'm contemplating -
1. What would it take to turn KIK into a stop codon to balance the ATG start codon, and how would that affect the rest of the sequence?
2. is KIK an IKYOIK kind of thing, and if so, how would that affect the rest of the sequence?
This may not make any sense at all. |
| Code: | K I K
113 111 113
aac aaa aac
Asn Lys Asn
|
Not sure how that would affect the rest, as we only have 6 decoding/shift numbers against 7, or now 8 codons/aminoacids, and I'm already assuming that ignoring the first (start) codon is the way to go.
Last edited by deagol on Fri May 11, 2007 1:16 am; edited 1 time in total |
|
| Back to top |
|
|
|
FAQ
Search
Memberlist
Usergroups
Register
Profile
Log in to check your private messages
Log in
