| View previous topic :: View next topic |
| Author |
Message |
McPackage Casual Observer

Joined: 22 Jan 2007 Posts: 76 Location: California
|
Posted: Thu Feb 08, 2007 12:23 pm Post subject: Traveler J - "Catalyst (Find Him)" [02/08/2007] |
|
|
Here's all the info discovered so far in the latest video, titled "Catalyst (Find Him)", which can be viewed at http://www.youtube.com/watch?v=egMFKctGzoE
The description is:
| Quote: |
If we value the pursuit of knowledge, we must be free to follow wherever that search may lead us.
|
The tags are:
| Quote: | | Search 5'3' Restriction FacilityJ OpAphid |
The following were taken from the "parcel" thread:
| McPackage wrote: | In the new video, I believe the morse code is:
| Code: |
...-- ---.. ---.. ..-. ----. -
|
which translates to 388F9T
|
| kellylen wrote: | which is a tiny url
http://tinyurl.com/388F9T
the text at the tinyurl is a code
| Code: | R0dBR1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUd
BVEdHQ0dHQ0NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUN
HQ0dHR0FHVEdBR0dHR0FHQ0FHVFRHR0dDQ0FBR0FUR
0dDR0dDQ0dDQ0dBR0dHQUNDR0dUR0dHQ0dBQ0dHR0
dHQUdUR0FHR0FUQ0NUVFRUVEFUVENUVENHQUNUQ0F
HR0FUQ0NHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0N
HR0NDR0NDR0FHR0dBQ0NHR1RHR0dDR0FDR0dDR0dBR
1RHQUdHR0dBR0NBR1RUR0dHQ0NBQUdBVEdHQ0dHQ0
NHQ0NHQUdHR0FDQ0dHVEdHR0NHQUNHR0dHQUdUR0
FHR0dHQUdDQUdUVEdHR0NDQUFHQVRHR0NHR0NDR0N
DR0FHR0dBQ0NHR1RHR0dDR0FDR0NHR0dBR1RHDQoNC
jEoLTQpIDcoLTQpIDggMSAyIDMgOSgtMSkgNCgrMyk= |
|
| kellylen wrote: | ok I did some more research.
base64 which converts to
| Code: |
GGAGTGAGGGGAGCAGTTGGGCCAAGAT
GGCGGCCGCCGAGGGACCGGTGGGCGACGCGG
GAGTGAGGGGAGCAGTTGGGCCAAGATGGCGGC
CGCCGAGGGACCGGTGGGCGACGGGGGAGTGAG
GATCCTTTTTATTCTTCGACTCAGGATCCGGGGAG
CAGTTGGGCCAAGATGGCGGCCGCCGAGGGACC
GGTGGGCGACGGCGGAGTGAGGGGAGCAGTTGG
GCCAAGATGGCGGCCGCCGAGGGACCGGTGGGC
GACGGGGAGTGAGGGGAGCAGTTGGGCCAAGATG
GCGGCCGCCGAGGGACCGGTGGGCGACGCGGGAGTG
1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)
|
which to me is a DNA sequence code. I'm not too sure about the numbers though |
|
|
| Back to top |
|
 |
blahblablee Lonely Fan
Joined: 31 Dec 2006 Posts: 237 Location: FacilityJ
|
|
| Back to top |
|
 |
blahblablee Lonely Fan
Joined: 31 Dec 2006 Posts: 237 Location: FacilityJ
|
Posted: Thu Feb 08, 2007 3:04 pm Post subject: |
|
|
| Actually nvm it some of the things aren't in that code... |
|
| Back to top |
|
 |
blahblablee Lonely Fan
Joined: 31 Dec 2006 Posts: 237 Location: FacilityJ
|
|
| Back to top |
|
 |
blahblablee Lonely Fan
Joined: 31 Dec 2006 Posts: 237 Location: FacilityJ
|
Posted: Thu Feb 08, 2007 4:14 pm Post subject: |
|
|
Um the tag says to search restriction 5'3'
Restriction enzymes...These break up DNA
This leads me to believe that the numbers represent breaks in the DNA... |
|
| Back to top |
|
 |
McPackage Casual Observer

Joined: 22 Jan 2007 Posts: 76 Location: California
|
Posted: Fri Feb 09, 2007 3:59 pm Post subject: |
|
|
One of the pages that comes up when searching for "5'3' restriction" is http://www.escience.ws/b572/L5/L5.htm . I can't figure out if that is supposed to help or not, but it does look to be related to the "Coded Rings" video (see http://www.youtube.com/watch?v=0mM6Eo0VyG8 ). Note that 2 of the tags on that video are "Decoder Ring".
Searching just for "5'3'" results in http://psyche.uthct.edu/shaun/SBlack/geneticd.html , which has a table very similar to the one used to decode the sequence in the previous puzzle. I did go ahead and decode the sequence, but I still am not clear on what the numbers are for. Here's the list, just in case it is relevant:
| Code: |
GGA Glycine
GTG Valine
AGG Arginine
GGA Glycine
GCA Alanine
GTT Valine
GGG Glycine
CCA Proline
AGA Arginine
TGG Tryptophan
CGG Arginine
CCG Proline
CCG Proline
AGG Arginine
GAC Asparagine
CGG Arginine
TGG Tryptophan
GCG Alanine
ACG Threonine
CGG Arginine
GAG Aspartic acid
TGA Ter [end]
GGG Glycine
GAG Aspartic acid
CAG Glutamine
TTG Leucine
GGC Glycine
CAA Glutamine
GAT Aspartic acid
GGC Glycine
GGC Glycine
CGC Arginine
CGA Arginine
GGG Glycine
ACC Threonine
GGT Glycine
GGG Glycine
CGA Arginine
CGG Arginine
GGG Glycine
AGT Serine
GAG Aspartic acid
GAT Aspartic acid
CCT Proline
TTT Phenylalanine
TAT Tyrosine
TCT Serine
TCG Serine
ACT Threonine
CAG Glutamine
GAT Aspartic acid
CCG Proline
GGG Glycine
AGC Serine
AGT Serine
TGG Tryptophan
GCC Alanine
AAG Lysine
ATG Methionine
GCG Alanine
GCC Alanine
GCC Alanine
GAG Aspartic acid
GGA Glycine
CCG Proline
GTG Valine
GGC Glycine
GAC Asparagine
GGC Glycine
GGA Glycine
GTG Valine
AGG Arginine
GGA Glycine
GCA Alanine
GTT Valine
GGG Glycine
CCA Proline
AGA Arginine
TGG Tryptophan
CGG Arginine
CCG Proline
CCG Proline
AGG Arginine
GAC Asparagine
CGG Arginine
TGG Tryptophan
GCG Alanine
ACG Threonine
GGG Glycine
AGT Serine
GAG Aspartic acid
GGG Glycine
AGC Serine
AGT Serine
TGG Tryptophan
GCC Alanine
AAG Lysine
ATG Methionine
GCG Alanine
GCC Alanine
GCC Alanine
GAG Aspartic acid
GGA Glycine
CCG Proline
GTG Valine
GGC Glycine
GAC Asparagine
GCG Alanine
GGA Glycine
GTG Valine
|
|
|
| Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
Posted: Fri Feb 09, 2007 5:11 pm Post subject: |
|
|
1(-4) 7(-4) 8 1 2 3 9(-1) 4(+3)
OK I am sure everyone tried this, but I have to post it.
1(-4) = -4
7(-4) = -28
then...
8
1
2
3
9(-1) = -9
4(+3) = 12 or +12
-4 -28 8 1 2 3 -9 12
Can't hurt, right? _________________ “It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight |
|
| Back to top |
|
 |
Brucker Casual Observer

Joined: 13 Oct 2006 Posts: 91
|
Posted: Fri Feb 09, 2007 6:25 pm Post subject: |
|
|
| McPackage wrote: | | I did go ahead and decode the sequence, but I still am not clear on what the numbers are for. Here's the list, just in case it is relevant: |
The problem with decoding DNA is that you have to know your starting point, which is why finding the 5'3' restriction is important. You've started decoding at the beginning, but even in real-life biology, DNA codes have strings of nonsense at the end.
The link you gave names "GGATCC" as a 5'3' restriction (I don't know if it's the only one; as much as I do know about DNA, I'm not a molecular biologist, and didn't follow the article very well) and that sequence appears twice in the given sequence. If that were the sequence to look for, then you would start coding on the second guanosine, yielding:
| Code: |
GAT Aspartic acid
CCT Proline
TTT Phenylalanine
TAT Tyrosine
TCT Serine
TCG Serine
ACT Threonine
CAG Glutamine
GAT Aspartic acid
CCG Proline
GGG Glycine
AGC Serine
AGT Serine
TGG Tryptophan
GCC Alanine
AAG Lysine
ATG Methionine or START
GCG Alanine
GCC Alanine
GCC Alanine
GAG Glutamic acid
GGA Glycine
CCG Proline
GTG Valine
GGC Glycine
GAC Aspartic acid
GGC Glycine
GGA Glycine
GTG Valine
AGG Arginine
GGA Glycine
GCA Alanine
GTT Valine
GGG Glycine
CCA Proline
AGA Arginine
TGG Tryptophan
CGG Arginine
CCG Proline
CCG Proline
AGG Arginine
GAC Aspartic acid
CGG Arginine
TGG Tryptophan
GCG Alanine
ACG Threonine
GGG Glycine
AGT Serine
GAG Glutamic acid
GGG Glycine
AGC Serine
AGT Serine
TGG Tryptophan
GCC Alanine
AAG Lysine
ATG Methionine or START
GCG Alanine
GCC Alanine
GCC Alanine
GAG Glutamic acid
GGA Glycine
CCG Proline
GTG Valine
GGC Glycine
GAC Aspartic acid
GCG Alanine
GGA Glycine
GTG Valine
|
This looks like what you have actually, but starting later. Actually, the presence of those "START" codons could be important as well, but I can't make heads or tails of the numbers. _________________ -BRUCKER
Teen1: He's cool.
Teen2: Are you being sarcastic, dude?
Teen1: I don't even know anymore.
(The Simpsons, "Homerpalooza") |
|
| Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Sat Feb 10, 2007 6:27 pm Post subject: |
|
|
I just wrote Traveler to ask why McPackage had to destroy J2, and he didn't do it himself. Here is the answer I received:
So it looks like "WD" are the initials of the man we are looking for. It also looks like we must identify the right enzyme. That's pretty much out of my league - hope you biochemists can handle that one. He points to clues in the video - seems there must be some we have missed. What I find most curious is the last sentence:
"finding the enzyme is a double-edged sword if you don't realize that it can cut twice."
*runs off to rewatch the last video and see what I've missed* _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
 |
kellylen The Order of Denderah

Joined: 21 Nov 2006 Posts: 2823 Location: New Jersey
|
Posted: Sun Feb 11, 2007 12:43 am Post subject: |
|
|
oiiiiiiii enzymes.
we would have to find the sequence for the proteins and then figure out which corresponds to the enzyme
as i just woke up im not going to do it.
maybe later today. _________________ -Kelly |
|
| Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Sun Feb 11, 2007 12:53 am Post subject: |
|
|
Are there special enzymes that can "cut twice"? _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
 |
kellylen The Order of Denderah

Joined: 21 Nov 2006 Posts: 2823 Location: New Jersey
|
Posted: Sun Feb 11, 2007 2:05 am Post subject: |
|
|
there maybe, I'm not quite sure yet as I only have just started studying biochemistry _________________ -Kelly |
|
| Back to top |
|
 |
blahblablee Lonely Fan
Joined: 31 Dec 2006 Posts: 237 Location: FacilityJ
|
Posted: Sun Feb 11, 2007 11:16 am Post subject: |
|
|
| Luminous wrote: | | Are there special enzymes that can "cut twice"? |
He's refering to the restriction enzymes:
From wikipedia:
A restriction enzyme (or restriction endonuclease) is an enzyme that cuts double-stranded DNA. The enzyme makes two incisions, one through each of the phosphate backbones of the double helix without damaging the bases. |
|
| Back to top |
|
 |
blahblablee Lonely Fan
Joined: 31 Dec 2006 Posts: 237 Location: FacilityJ
|
|
| Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Sun Feb 11, 2007 2:25 pm Post subject: |
|
|
Hey, I just stumbled upon this thread - I don't really know any of the backstory here, but I did a homology search on the DNA sequence, and it's a pretty good match with human nucleoporin (the protein complexes that allow molecules to enter and leave the cell's nucleus) DNA.
Don't know if that helps any, but there you go.
I do research in a molecular biology lab, so I'm pretty conversant with this stuff...feel free to PM me if you need.
EDIT: you guys also might want to try translating the DNA sequence into its one-letter protein codes, and see if it spells out anything. I couldn't find anything, but maybe there's a trick (Anagram? Special portion to decode?) |
|
| Back to top |
|
 |
|