Lonelygirl15

Luminous · Posted: Fri Feb 16, 2007 2:03 pm Post subject:

Here's a screen capture of a recent email exchange I had with him through YouTube. I wrote back and told him sorry, I'm only trying to help, and called him a cranky old fart. Maybe I shouldn't have done that. Not everyone understands my sense of humor. d'oh!

_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

McPackage · Posted: Tue Feb 20, 2007 8:31 pm Post subject:

Just got a message from walterdw on myspace:

sonieee · Posted: Tue Feb 20, 2007 9:00 pm Post subject:

yeah I got that message too, just now.

theresascraps · Posted: Tue Feb 20, 2007 9:08 pm Post subject:

He has a new vid up! i believe it could have something to do with genetic research. Check it out and you will see.

Theresa

theresascraps · Posted: Tue Feb 20, 2007 9:19 pm Post subject:

here you go off the new walterdw vid. I entered the numbers from the opening sequence
36gy77
it led my to craigslist and the posting below. i need help, the whole gene thing is so not my game!

theresa

Luminous · Posted: Tue Feb 20, 2007 10:20 pm Post subject:

Here's what the Base 64 from the Craig's list message translates to:

We knew the Soviets had them. They were at least ten years ahead of
us. The Kirov and Sverdlovsk facilities were producing results before we
had even begun. It wasn't hard for some half-witted military drones to
weaponize the standards, although I do feel for the whitecoats. Lovett
wanted something more from us, the intellectual elite. We were to
produce a more discrete product.

gaagagcaagcgccatgttgaagccatcattaccattcacatccctcttattcctgcagctgcccctgctggg
agtggggctgaacacgacaattctgacgcccaatgggaatgaagacggatccaccacagctgtcgagtg
ggaaatctgggactggagggggctggtgagaagggtggctgtgggaaggggccgtacagagatctggt
gcctgccactggccattacaatcatgtgggcagaattgaaaagtggagtgggaagggcaagggggagg
gttccctgcctcacgctacttcttctttctttcttgtttgtttgtttctttctttcttttgaggcagggtctcactatgttg
cctaggctggtctcaaacggatcctcctggctcgactctagtgatcctcctgcctcagcctttcaaagcacca
ggattacagacatgagccaccgtgcttggcctcctccttctgaccatcatttctctttccctccctgccttcatttt
ctccccaatctagatttcttcctgaccactatgcccactgactccctcagtgtttccactctgcccctcccagga
tccgaggttcagtgttttgtgttcaatgtcgacatatgagcatggcgaccagcaccttcagtgcgcagtgtgg
cccggagcatcattacctggctgaacattcttctatttttaatggcgtcttcagccagcagcttaaaaacaac
cttatctactttccctcctcctactttccctcctcccgcttgagggtaggccccatccccccctttcgagtacatg
gatccgaattgcacttggaacagcagctctgagccccagcctaccaacctcactctgcattattggtatgag
aagggacgagggggaggggatgaagaagaggtgggttggatcagagaccaagagagagggtagca
agtctcccaggtaccccactgttttctcctggggtaagtcataagtcggttgaggggagatgaggctaggct
ctggatatctgcagtacccagattggccccactgttcctcttccttccatcgaacctttctcctctaggtacaag
aactcggataatgaggatcctaaagtccagaagtgcagccactatctattctctgaagaaatcacttctggc
tgtcagttgcaaaaaaaggagatccacctctaccaaacatttgttgttcagctccaggacccacgggaacc
caggagacaggccacacagatgctaaaactgcagaatctgggtaatttggaaagaaagggtcaagag
accagggatactgtgggacattggagtctacagagtagtgttcttttatcataagggtacatgggcagaaa
agaggaggtaggggatcatgatgggaagggaggaggtattaggggcactaccttcaggatcctgacttg
tctaggccagggtcgagaatgaccacatatgcacacatatctccagtgatcccctgggctccagagaacct
aacacttcacaaactgagtgaatcccggatccagctagaactgaactggaacaacagattcttgaaccac
tgtttggagcacttggtgcagtaccggactgactgggaccacagctggactgtgagtgactagggacgtg
aatgtagcagctaaggccaagaa

1(+8 ) 1 3(+7) 2(-1) 3(-6) 1(+4) 1(+3) 2(+3) 5 1 6 1 1(-1) 4 7 2 6 9 9 1 5 4 1 1 2 3 1 2 4 4(+1) 5(-1) 5 3 9 9 1 3 1(+1) 1 4 1(+2) 1 2 2 2 2 1 2 2 2 2 2 2(+1) 4 1 7 6 1 6 7 1
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

theresascraps · Posted: Tue Feb 20, 2007 10:25 pm Post subject:

I am sorry if i screwed up the screen. I don't know how to do the screencaps thing. So, what does the message mean??How did you decipher it so quickly???

Theresa

Luminous · Posted: Tue Feb 20, 2007 10:41 pm Post subject:

Luminous · Posted: Tue Feb 20, 2007 10:49 pm Post subject:

Whoa! Check this out! I just did a google on Kirov and Sverdlovsk. Look what I found!

http://www.house.gov/jec/hearings/intell/alibek.htm

I haven't had a chance to read through it yet but it looks pretty interesting.
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

Interesting - this new DNA sequence contains a lot of X-chromosome material, which fits in with what some of us were speculating earlier.

Also, it looked like the baby in the video had bent bones? Interesting.

I'll see what I can do with this new sequence.

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

Hmm, I played around with a bunch of stuff, but I'm coming up dry. I wonder whether there are any clues about which enzymes to use...

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

Hmmm....could "Terminus A Quo" refer to the Taq restriction enzyme? Hmm....

Luminous · Posted: Wed Feb 21, 2007 1:09 am Post subject:

How did you isolate the enzyme last time?
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

TOSG · Devoted Fan Joined: 14 Sep 2006 Posts: 651

Mostly lucky guesses, to be honest. I looked for commonly used restriction enzymes that cut out the sequence that didn't match up with known DNA (as I assumed that TravelerJ designed it specifically for this puzzle).