 |
Lonelygirl15 Forum to post messages about Bree and Danielbeast
|
View previous topic :: View next topic |
Author |
Message |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Feb 28, 2007 8:53 pm Post subject: |
|
|
Sorry I wasn't clear about the table. This is how it works: you have a letter [a t g c] and you want to vigenere it into another (or even the same) letter of the same set [a t g c]. The table gives you the 4*4 possible keys for doing that. All those a's are just the key you would use to keep the letter unchanged, because any letter ciphered with 'a' as a key isn't shifted at all. In other words, a=0 regarding the key shift.
For example, the first letter that doesn't decode from the original sequence is the 28th (t). So, you would look in the table the row that ciphers into 't' (2nd row) to find the possible keys that would code a valid DNA character, the possible keys are [t a n r] and that 't' would decript into [a t g c] respectively.
Ok I just realized you don't need to try every combination to complete the key, just padding it with x's or z's would show you when it's the proper length to make it all happen, and I'm sorry to say I tried quite a few lengths but none worked. I also realized that there could be an extra letter in the key, but tried removing quite a few and still doesn't look like it's working, eventhough some parts do fall into a valid DNA sequence.
I think the stamp may have been separated into words like that for a reason. Maybe the key does not repeat like in a vigenere cipher, but it keeps changing (based on those words) like in a one-time pad. This idea fits well with what Walter said about an chiffre indéchiffrable: that is precisely what a one-time pad is... that is, of course, if you don't know anything about the key. |
|
Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Wed Feb 28, 2007 9:07 pm Post subject: |
|
|
This is kind of interesting, although I'm not sure that it's the answer we're looking for.
If you decode the DNA sequence that I found in the previous puzzle in the 3' ---> 5' direction (rather than 5'--->3'), then reverse the protein sequence, the first five amino acids spell out "SMILE" when decoded with "11228."
Maybe it's coincidence, but perhaps one of you Myspacers should try submitting that as his last name. |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Wed Feb 28, 2007 9:20 pm Post subject: |
|
|
Too bad. I tried it and it didn't work. If it had it would have totally shifted my opinion on him. Oh, well. No such luck. _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Wed Feb 28, 2007 9:55 pm Post subject: |
|
|
Try "Dabrowski."
I'll explain if it works  |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Wed Feb 28, 2007 10:19 pm Post subject: |
|
|
TOSG you are a genius! He accepted it
 _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Wed Feb 28, 2007 10:31 pm Post subject: |
|
|
Haha, glad we finally solved it. I can't claim to being most of the brains behind this one, and I'm pretty dismayed that I didn't see this earlier.
Here goes:
Deagol (Or perhaps someone else, earlier. Props to whoever it was.) pointed out that when you use the code on Walter's "stamp" to decode the DNA sequence that I solved for the previous puzzle, the first 25 or so letters are also DNA code. Obviously, this could not be due to mere chance.
So, I looked at this sequence. It was only 26 letters long. I thought that it would be nice to have a 27-letter sequence, as this is a multiple of three, and the same length as the code in the stamp. I noticed that if you only use the first 26 letters of the code on the stamp, you get 27 (actually 2 letters of DNA code.
So, I put this DNA sequence into a protein translator. Then, I used the first nine numbers of the decoding sequence for the previous puzzle, and voila - The Big "Dabrowski" appears.
For the curious:
The DNA sequence: gttgccctgatcctgagctttttcgcgg
The protein sequence: V A L I L S F F A |
|
Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Wed Feb 28, 2007 11:03 pm Post subject: |
|
|
So, what's on the myspace, by the way? |
|
Back to top |
|
 |
trainer101 Moderator Manager

Joined: 20 Sep 2006 Posts: 2671 Location: Wasting away again ILLUMINATIVILLE...
|
Posted: Wed Feb 28, 2007 11:04 pm Post subject: |
|
|
Beautiful! Amazing collaboration!
The puzzles get more and more complex - wonder what the next one will bring?
More importantly, I wonder where this is going... _________________ It's STILL all connected... |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Wed Feb 28, 2007 11:23 pm Post subject: |
|
|
A big standing ovation to everyone who helped on this one! I'll go back and gather all the names and try to not miss any!
I went to Walters MySpace and input Dabrowski as his last name in my friend request, and, as I have already mentioned, it worked.
So now we wait to see if he is willing to accept it, but of course he is, he has already said as much in his emails.
He has to accept. We are his only hope. (help me obe wan kenobi - no, lets not go there )
He is, however, a pretty old cranky dude, so this could take awhile. (Is there a foot tapping smiley? I couldn't find one.) Anyway, we made him wait, and he doesn't move that fast, even when he's in a hurry so . . . . . . . . . . . .
For anyone who wants to add Walter as a friend, here's the URL
http://myspace.com/walterdw
Last Name: DABROWSKI
( sorry for shouting so loud, I'm just so excited ) _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Thu Mar 01, 2007 12:31 am Post subject: |
|
|
TOSG wrote: | So, what's on the myspace, by the way? |
The answer to this probably got lost in my celebration
We are waiting for Walter to respond and accept our friend request. Knowing Walter, this could take awhile, but I hope not. I posted the URL to his myspace above for anyone who wants to invite Walter to be friends  _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Thu Mar 01, 2007 12:56 am Post subject: |
|
|
Here is the list of everyone who contributed to discovering the true identity of Walter Dabrowski, of Facility J.
In order of appearance:
McPackage
Blahblablee
janesalteredstates
Brucker
Luminous
kellylen
TOSG
Trainer101
Weepel
Sonieee
theresascraps
autumneternal
theslyestfox
kayokosaiki
Mellie3204
deagol
Good work all! _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
Back to top |
|
 |
trainer101 Moderator Manager

Joined: 20 Sep 2006 Posts: 2671 Location: Wasting away again ILLUMINATIVILLE...
|
Posted: Thu Mar 01, 2007 1:05 am Post subject: |
|
|
Luminous, did you get your editing software cranked back up? I'd love to see the "step by step" in video. _________________ It's STILL all connected... |
|
Back to top |
|
 |
theslyestfox Casual Observer

Joined: 09 Jan 2007 Posts: 44 Location: B.C., Canada
|
Posted: Thu Mar 01, 2007 1:09 am Post subject: |
|
|
TOSG wrote: | Haha, glad we finally solved it. I can't claim to being most of the brains behind this one, and I'm pretty dismayed that I didn't see this earlier.
Here goes:
Deagol (Or perhaps someone else, earlier. Props to whoever it was.) pointed out that when you use the code on Walter's "stamp" to decode the DNA sequence that I solved for the previous puzzle, the first 25 or so letters are also DNA code. Obviously, this could not be due to mere chance.
So, I looked at this sequence. It was only 26 letters long. I thought that it would be nice to have a 27-letter sequence, as this is a multiple of three, and the same length as the code in the stamp. I noticed that if you only use the first 26 letters of the code on the stamp, you get 27 (actually 2 letters of DNA code.
So, I put this DNA sequence into a protein translator. Then, I used the first nine numbers of the decoding sequence for the previous puzzle, and voila - The Big "Dabrowski" appears.
For the curious:
The DNA sequence: gttgccctgatcctgagctttttcgcgg
The protein sequence: V A L I L S F F A |
OMGOMGOMGOMG!!!YAY!!! you are SO AMAZING!!
i thought that reversing the original DNA strand and somehow decoding it was going to be the first step, but bravo to Deagol for figuring out the key, and bravo to you for figuring out the whole thing!! i am so in awe of your DNA decoding prowess. this would certainly be a lost cause if we didn't have you on the team!! <--- weeping with joy! _________________ Let's prove science wrong for the rest of our lives!!!
http://www.youtube.com/theslyestfox |
|
Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
Posted: Thu Mar 01, 2007 1:41 am Post subject: |
|
|
TOSG you are a frigging genius!
Luminous hahah thanks for adding me to the list, although I wasn't all that helpful.
YAY!
... off to myspace _________________ “It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight |
|
Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Thu Mar 01, 2007 2:07 am Post subject: |
|
|
trainer101 wrote: | Luminous, did you get your editing software cranked back up? I'd love to see the "step by step" in video. |
Video software is still on vacation, but I can put something together in flash. I'm on it  _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
Back to top |
|
 |
|
|
You cannot post new topics in this forum You cannot reply to topics in this forum You cannot edit your posts in this forum You cannot delete your posts in this forum You cannot vote in polls in this forum
|
Powered by phpBB © 2001, 2005 phpBB Group
|