Lonelygirl15

[Luminous]

The package arrived today, 3/08/07, via usps priority mail. It was addressed to “Resident”, written in black felt tip pen. The return address, written in red ink, was:

Dabrowski
200 Lakeview Terrace
Princeton NJ 08540

Inside the box was a black case like the one McPackage received. On top of the case was a 3x5 card that read "You have been helpful so far. To destroy J3 and J4, simply open the vials and let the samples disperse in an open area. I have also included some reading that you may find hits close to home. WD"



Inside the black case was a new copy of “This Side of Paradise” by F. Scott Fitzgerald. The UPC code is 9-780671-535551 (in case anyone wants to know.) Underneath the book, strapped into blue eggshell foam were two clear plastic vials with white caps, labled J3 and J4.



The samples have been destroyed, as instructed, evidence posted here.



Several pages of the book were dog eared and marked up as follows

Page 17
Midway down the page, the word the first four letters of the word “noticed” (noti) had a rectangle drawn around them in blue ballpoint ink. In the right hand margin of the same page the following number sequence was written in blue ball point ink:

7(-11) 3(+1) 4 2 6(-9) 2(+1) 4 6 3 1 2 1 2 5 1 1(+1) 1(+1)



Page 43
midway down the page, "12 University Place" was highlighted in blue marker. Written at the bottom of the page in blue ballpoint ink was:
0312-0316



Page 245
Approximately 1/3 down the page the question "Do you mind if I drop the Don?” was highlighted with blue marker.



Pages 284/285
In addition to being dog eared, these two pages were divided by a 3x5 card “bookmark”



with these letters written in black felt tip pen:

h y d y m y z h a m e k i z r b y d y w r a h a a t l l w
m i g n s e h n k o v l l z r w c v w f l s q b h f s f k
g z a l b m n c x b g k n f u t f y f



At the bottom of page 284 and the top of 285, the following text was highlighted in yellow marker: "He was ashamed of the fact that very simple and honest people usually distrusted him; that he had been cruel, often, to those who had sunk their personalities in him--several girls, and a man here and there through college, that he had been an evil influence on; people who had followed him here and there into mental adventures from which he alone rebounded unscathed.

Usually, on nights like this, for there had been many lately, he could escape from this consuming introspection by thinking of children and the infinite possibilities of children”



I have photographed everything in excrutiating detail , If anyone wants a close up, or a specific shot of anything, just let me know, and I will post it
_________________
You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess

[Ziola]

Nice job, Luminous. The pictures are fantastic. I think for obvious reasons the number sequence needs to be fixed so that the math is done.

That gives us this numer sequence:

-77 4 4 2 -54 3 4 6 3 1 2 1 2 5 1 2 2

Just for giggles, I googled Noti. Its a town in Oregon. And University Place is an area in Washington State.

For what its worth...probably not helpful, but my coffee hasn't kicked in yet.

[theresascraps]

I used to leave in University Place washington, my inlaws still do. I have also been to Noti Oregon, as we used to leave on the coast of oregon as well.
Great pics luminous. this is so exciting. whick part should we solve first?

theresa

[TOSG]

NotI is a restriction enzyme. I've got to run for right now, but I'll try to look at this puzzle further sometime tonight.

[Ziola]

http://www.fermentas.com/catalog/re/noti.htm

[Luminous]

[McPackage]

[Luminous]

[Ziola]

[Luminous]

[LONGTIMELURKER]

is this lg15 related ?
_________________
The difference between Bree and Sarah is this ....

Bree- Classicly Beautiful/sweet/ "pure"/Vogue

Sarah-Modern Day HOT/ naughty/"dirty"/Penthouse

[trainer101]

[Luminous]

[TOSG]

I'm making progress on something here. I'll update in a little bit.

UPDATE: Okay, now I'm stuck. I did, however, make some progress. I think I'm on the right track, but maybe one of you guys can help me out from here. Here's what I did:

I decoded the excerpt on page 284/5 using the Vigenere cipher passphrase given on the notecard. I obtained the following DNA sequence (the first 82 letters of the decoded result):

agtcgctaaaatggcGgccgctaatctgcgagctat
atttcttctcttgtccttgtttcttgtggcggccgcgacgct

I then put this sequence through a restriction analysis tool. As expected, I found two NotI cut sites. Better yet, the remaining DNA was 51 base pairs long. That's three times seventeen, the number of decoding numbers that Walter gave on page 17.

This sequence is:

ggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggc

BUT, putting this sequence into a protein translator didn't do me much good. There was a stop codon in the original sequence, and the reverse, complement, and reverse-complement sequences didn't seem too promising either, although I didn't do a full translation.

Let me know if you guys think of anything to try next - I'll keep thinking about this.

[TOSG]

Got it! Solution coming soon.

Here it is:

So, despite the stop codon in the translated sequence, I decided just to treat "stop" as a word, like any other amino acid. I got the following translation:

"Thpeefoursevensdh"

I figured that the "p" in the third position should be an "r." Maybe this was Walter's mistake, or maybe he was just trying to keep us guessing. Anyway, this led to the following tinyurl:

http://tinyurl.com/347sdh


BUT, then I cheated. Noticing that this redirected to the same photobucket album that Walter used previously, I checked the index and also found the following photo, labelled "drop":

http://i150.photobucket.com/albums/s118/WalterDW/drop.jpg

Nevertheless, I think I'll see what I can do with the code in the stamp on the new telegram.