| View previous topic :: View next topic |
| Author |
Message |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Fri Mar 09, 2007 9:28 pm Post subject: |
|
|
| trainer101 wrote: | | Luminous wrote: | | Maybe we could write up some instructions post them in the toolkit on the LGpedia page? |
That's a real good idea. I was just looking through LGpedia, you've done a great job! |
Yeah, it's not a bad idea. Technical writing is hardly one of my passions, but I do recognize that it would be helpful for a lot of people. I might try my hand at it later on. I do think that it's most instructive just to play around with the various tools, though. Take an old puzzle and try to solve it, using my solution breakdowns as guidelines, as much or as little as you fancy. |
|
| Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Fri Mar 09, 2007 9:44 pm Post subject: |
|
|
Thanks Trainer You made my day
So I know some people near Princeton. Should I start making phone calls? _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
 |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Fri Mar 09, 2007 10:41 pm Post subject: |
|
|
I tried to follow along with TOSG, but he was always one step ahead of me. Must have been because I did try to document everything linearly. That 'p' that was supposed to be an 'r' gets fixed when using the "right" stop.
Sorry if this is mostly redundant, and for abusing the wide formatting, but it was the clearest way I could think to show the number decoding. Hope it helps!
NotI:gcggccgc
| Quote: | He was ashamed of the fact that very simple and honest people usually distrusted him; that he had...
|
Vigenere decrypt:
| Code: | text:hewasashamedofthefactthatverysimpleandhonestpeopleusuallydistrustedhimthatheh
key1:hydymyzhamekizrbydywrahaatllwmignsehnkovllzrwcvwflsqbhfsfkgzalbmncxbgknfutfyf
msg1:agtcgctaaaatggcggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggcggccgcgacgc
|
NEBcutter (select 2 cutters link after first result):
| Code: | seq1:agtcgctaaaatggcggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggcggccgcgacgc
--^----- --^-----
Cuts: NotI NotI
seq2: ggccgctaatctgcgagctatatttcttctcttgtccttgtttcttgtggc
|
Protein 1-letter code translation and full names (notice the stop is taa=Ochre):
| Code: | pr.trans:G R Ochre(stop) S A S Y I S S L V L V S C G
pr.names:Glycine_Arginine_Ochre_Serine_Alanine_Serine_Tyrosine_Isoleucine_Serine_Serine_Leucine_Valine_Leucine_Valine_Serine_Cysteine_Glycine
^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^
letters#: 7 3 4 2 6 2 4 6 3 1 2 1 2 5 1 1 1
egreneoursevenscg
|
shifts:-11 1 0 0 -9 1 0 0 0 0 0 0 0 0 0 1 1
For this part I also like to use the Vigenere tool, deriving a key from the shifts by making 0=a, 1=b, -1=25=z, etc.
Vigenere encrypt:
| Code: | ltr1:egreneoursevenscg
key2:pbaarbaaaaaaaaabb
msg2:threefoursevensdh
|
http://tinyurl.com/347sdh
From the stamp, Vigenere decrypt:
| Code: | seq2:ggccgctaatctgcg
key3:egajecrhyrcaacg
msg3:cactcactccatgaa
|
Again, protein 1-letter code translation and full names:
| Code: | pr.trans:H S L H E
pr.names:Histidine_Serine_Leucine_Histidine_Glutamate
^ ^ ^ ^ ^
letters#: 7 3 4 2 6
ircim
|
And finally the same shifts, Vigenere encrypt:
| Code: | ltr2:ircim
key2:pbaar
msg4:xscid
|
http://en.wikipedia.org/wiki/XSCID
| Quote: | | It is also known as the "bubble boy" disease because its victims are extremely vulnerable to infectious diseases. |
Kind of brings me back to the telegram, "...they wanted a way to protect a chosen few."
Tools used (also linked on each step):
http://rumkin.com/tools/cipher/vigenere.php
http://tools.neb.com/NEBcutter2/index.php
http://www.expasy.ch/tools/dna.html
http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table
Last edited by deagol on Fri Mar 09, 2007 10:53 pm; edited 2 times in total |
|
| Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Fri Mar 09, 2007 10:51 pm Post subject: |
|
|
Nice work documenting everything, deagol. If people find that sort of formal approach to be easier to follow, let me know - I can start documenting my solutions like that as well.
And good work getting the "r" in "three"! I didn't think to actually use the name of the stop codon - that's pretty obscure, so it's awesome that you figured it out.
And Luminous: Sure, if you think they'd be willing/interested. There's a good possibility that it could be a wild goose chase, but I'm not sure how best to narrow in on what we're exactly looking for.
It might not be a bad idea for someone to send Walter a message and see if he can confirm that there's been a drop, so that nobody wastes their time on the ground.
EDIT: Sorry, deagol, I bollocksed your username! It's corrected now, though.
Last edited by TOSG on Fri Mar 09, 2007 11:31 pm; edited 1 time in total |
|
| Back to top |
|
 |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Fri Mar 09, 2007 11:14 pm Post subject: |
|
|
Well I don't think every step needs to be documented like that from now on once people learn how it's done. Indeed you did a great job explaining it before and although I can catch on pretty quickly, I know how tough these things are for others. I thought showing it step by step with all the details and linking the corresponding tools might also help with the suggestion of a tutorial here.
I think this is definitely a drop in Princeton, and I like 0312-0316 beeing room numbers (or maybe mailbox numbers) at 12 University Place in Princeton. That's as narrowed-down a location as you can get.
And this is interesting, also from that wiki page on XSCID:
| Quote: | | Trial treatments of SCID have been gene therapy's only success; since 1999, gene therapy has restored the immune systems of at least 17 children with two forms (ADA-SCID and X-SCID) of the disorder. |
Might there be 2 more kids? You know, the J19...
Last edited by deagol on Fri Mar 09, 2007 11:24 pm; edited 1 time in total |
|
| Back to top |
|
 |
trainer101 Moderator Manager

Joined: 20 Sep 2006 Posts: 2671 Location: Wasting away again ILLUMINATIVILLE...
|
Posted: Fri Mar 09, 2007 11:21 pm Post subject: |
|
|
Amazing work again Deagol and TOSG! You are in a groove - the last puzzle took days.
I agree, we should get some confirmation from Walter or TravelerJ before we send anyone on a wild goose chase. _________________ It's STILL all connected... |
|
| Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Fri Mar 09, 2007 11:25 pm Post subject: |
|
|
| TOSG wrote: | | It might not be a bad idea for someone to send Walter a message and see if he can confirm that there's been a drop, so that nobody wastes their time on the ground. |
Excellent idea (duh) I just dropped Walter a line to let him know the package was received and has been decoded and we're wondering . . .
I've sent out a few inquiries on possible drop retrievers. No takers yet. If we get confirmation back from Walter, maybe ladron121 from the OpAphid crew would be willing to lend us one of his drop retrievers, if he has anyone near Princeton?
Oh, and Deagol. WOW! What a breakdown. Thanks. _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
 |
shadower Suspiciously Absent

Joined: 25 Nov 2006 Posts: 20 Location: United States
|
Posted: Fri Mar 09, 2007 11:37 pm Post subject: |
|
|
wow I just stumbled upon this and I have to say I love this!
I'm bio nerd and genetics/dna is my favorite part!
Also if there was a drop, i would have loved to help because I'm on a few hours drive away, (here comes the big but!!) I'm driving back to school this weekend and it's in the completely opposite direction.
So quick question (because i'm lazy, it's late and so on) have all the problems, so far, been dna-ish based? or have they been more like the opaphid style, where knowledge of specific computer coding is needed? _________________ "The true work of art is but a shadow of the divine perfection." ~Buonarroti Michelangelo
I'm just an observer, loving the game... |
|
| Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Fri Mar 09, 2007 11:39 pm Post subject: |
|
|
| shadower wrote: | wow I just stumbled upon this and I have to say I love this!
I'm bio nerd and genetics/dna is my favorite part!
Also if there was a drop, i would have loved to help because I'm on a few hours drive away, (here comes the big but!!) I'm driving back to school this weekend and it's in the completely opposite direction.
So quick question (because i'm lazy, it's late and so on) have all the problems, so far, been dna-ish based? or have they been more like the opaphid style, where knowledge of specific computer coding is needed? |
Yep, the ARG and its puzzles have a definite scientific theme. Check out some of the previous puzzle threads and also Luminous' article on FacilityJ in the LGPedia. |
|
| Back to top |
|
 |
deagol Thor's Hammer

Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Fri Mar 09, 2007 11:41 pm Post subject: |
|
|
| TOSG wrote: | | EDIT: Sorry, deagol, I bollocksed your username! It's corrected now, though. |
Haha... I thought you had it right in the first place, as I've pretty much been a "Lurker" in this side of the forum.  |
|
| Back to top |
|
 |
Ziola The Order of Denderah

Joined: 17 Oct 2006 Posts: 5774
|
Posted: Sat Mar 10, 2007 9:19 am Post subject: |
|
|
| Well, I'm at least on the East Coast (New England) but Princeton is a tad to far away for me. I do have people I can call down in that area though, if the need arises. Let me know if you all get confirmation from Walter and I'll get on the horn. |
|
| Back to top |
|
 |
janesalteredstates Devoted Fan

Joined: 12 Jan 2007 Posts: 763 Location: Jenlight's head
|
Posted: Sat Mar 10, 2007 2:57 pm Post subject: |
|
|
Wow, I always get here too late.
But let me know when Walter gets to Fiji  _________________ “It takes a thousand voices to tell a single story. ”
http://youtube.com/profile?user=jenlight |
|
| Back to top |
|
 |
ladron121 Devoted Fan
Joined: 24 Oct 2006 Posts: 855
|
Posted: Sun Mar 11, 2007 1:15 pm Post subject: |
|
|
My ears were burning, knew my name was mentioned
Sadly, I'm in Sacramento, CA. Princeton is too much of a drive
However, hit me up if there's anything going on in Nor Cal |
|
| Back to top |
|
 |
TOSG Devoted Fan

Joined: 14 Sep 2006 Posts: 651
|
Posted: Sun Mar 11, 2007 8:24 pm Post subject: |
|
|
| Any word from Walter on whether the suspected drop has indeed occurred? |
|
| Back to top |
|
 |
Luminous Thor's Hammer

Joined: 26 Nov 2006 Posts: 1359 Location: Facility J
|
Posted: Sun Mar 11, 2007 8:37 pm Post subject: |
|
|
Nothing yet. He's remaining suspiciously silent. _________________ You made a wise choice, Bree.
There's no place like home.
Click to watch: The Ice Princess |
|
| Back to top |
|
 |
|