|
Lonelygirl15 Forum to post messages about Bree and Danielbeast
|
View previous topic :: View next topic |
Author |
Message |
Loki Lonely Fan
Joined: 25 Sep 2006 Posts: 143 Location: Right behind you...
|
Posted: Wed Mar 28, 2007 8:51 am Post subject: |
|
|
Maybe we're supposed to drop the repeating letters and decode what's left?
So RORKRKRCRRRK would become OKKCRK... I think... _________________ A trickster god with a modern twist.
Everything is not as it first appears.
Knowledge is power. Knowledge shared is power lost. -- Aleister Crowley |
|
Back to top |
|
|
deagol Thor's Hammer
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Mar 28, 2007 10:48 am Post subject: |
|
|
Using this:
Code: | 6(-3) 6(-1) 6(-3) 12(-8) 6(-3) 12(-8) 6(-3) 12(-0) 6(-3) 6(-2) 6(-3) 12(-8)
Isoleucine_Proline_Isoleucine_IsoleucineIs_Isoleucine...Aspartic_acid_Isoleucine_IsoleucineIso
^ ^ ^ ^ ^ ... ^ ^ ^
6 6 6 12 6 ... 6 6 12
UNUSUSUCUTUS
RMRKRKRCRRRK
Or using the alternative shifts:
6(-6) 6(-1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
UNUSUSUCUTUS
OMOOOOOCOOOO
|
I thought those O's were weird, but with Trav's recent fix that M turns into another O!
So I started playing with ceasar ciphers, and eventually plugged RORKRKRCRRRK as the message and OOOOOOOCOOOO as the key (fixed the second letter as per Trav's correction), chose decrypt, and out came:
DADWDWDADDDW
Could it be that WalterDW is TravelerJ19's dad? I'm waiting for his confirmation. |
|
Back to top |
|
|
TOSG Devoted Fan
Joined: 14 Sep 2006 Posts: 651
|
Posted: Wed Mar 28, 2007 11:56 am Post subject: |
|
|
Interesting.
And, at least we know that the shifts are correct now. |
|
Back to top |
|
|
deagol Thor's Hammer
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Mar 28, 2007 12:31 pm Post subject: |
|
|
TOSG wrote: | Interesting.
And, at least we know that the shifts are correct now. |
The thing is, that result uses both shifts. In fact, his "fix" for the second letter doesn't affect the result! It only makes it more odd because another O gets decoded, but actually any other DNA sequence, with whatever choice of numbers to pick letters (the 6's and 12's), would result in 2 alternative codes that when decrypted against each other you'd get DADWDW (there seems to be a glitch in the antepenultimate letter). This is because those operations are the equivalent of taking the difference in the alternative (a b c d) responses and converting what you get through a=0, b=1, etc.
Code: | 3 1 3 8 3 8 3 0 3 2 3 8 (track numbers as they appear in the lyrics file)
6 1 6 4 6 4 6 0 6 5 6 4 (track numbers as they appear in the MP3 files )
3 0 3 -4 3 -4 3 0 3 3 3 -4 (difference)
d a d w d w d a d d d w (a=0, d=3, w=-4)
|
This makes me think the DadWDW may be a fluke. |
|
Back to top |
|
|
deagol Thor's Hammer
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Mar 28, 2007 12:59 pm Post subject: |
|
|
I'm tired of taking screencaps...
Quote: | From: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Subject: Re: Re: 6 and 12
Message:
That is an interesting result, but not what I'm going for. That first gibberish you sent me means nothing. Stick with your O's. Maybe you'll see something that looks out of place.
DeagolTheStoor wrote:
> Well I got the impression your previous message was confirming those shifts instead of the mp3 ones.
> So, I used one result as a key to decode the other, and got this:
>
> DADWDWDADDDW
>
> Are you saying Walter is your dad?
>
|
So, back to square 1, I guess.
Code: | 6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
U N U S U S U C U T U S
-6 +1 -6 -4 -6 -4 -6 -0 -6 -5 -6 -4
O O O O O O O C O O O O
|
What looks out of place is that C (it came from the 12th letter in OchreOchreOchre). In order to fix it, it would have to be an O. Maybe it should've been the 11th letter, or the 6th, or the 1st. Or I could keep the 12th letter C, but change that odd (-0) shift, where I would need a (+12) to get an O. Or perhaps I should've used Stop and it'd be the 3rd, 7th, or 11th letter. Or if I kept the 12th letter, a P, It'd require a (-1) shift. Or maybe he just wants me to fix that codon so an O comes out? Even then, I don't know what's the point of getting all O's. I think this puzzle sucks. |
|
Back to top |
|
|
ignatzmouse Enthusiastic Fan
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Wed Mar 28, 2007 1:11 pm Post subject: |
|
|
deagol wrote: | I'm tired of taking screencaps...
Quote: | From: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Subject: Re: Re: 6 and 12
Message:
That is an interesting result, but not what I'm going for. That first gibberish you sent me means nothing. Stick with your O's. Maybe you'll see something that looks out of place.
DeagolTheStoor wrote:
> Well I got the impression your previous message was confirming those shifts instead of the mp3 ones.
> So, I used one result as a key to decode the other, and got this:
>
> DADWDWDADDDW
>
> Are you saying Walter is your dad?
>
|
So, back to square 1, I guess.
Code: | 6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
U N U S U S U C U T U S
-6 +1 -6 -4 -6 -4 -6 -0 -6 -5 -6 -4
O O O O O O O C O O O O
|
What looks out of place is that C (it came from the 12th letter in OchreOchreOchre). In order to fix it, it would have to be an O. Maybe it should've been the 11th letter, or the 6th, or the 1st. Or I could keep the 12th letter C, but change that odd (-0) shift, where I would need a (+12) to get an O. Or perhaps I should've used Stop and it'd be the 3rd, 7th, or 11th letter. Or if I kept the 12th letter, a P, It'd require a (-1) shift. Or maybe he just wants me to fix that codon so an O comes out? Even then, I don't know what's the point of getting all O's. I think this puzzle sucks. |
Using "StopOchre" gets the desired "OOOOOOOOOOOO" result. _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
|
deagol Thor's Hammer
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Mar 28, 2007 1:22 pm Post subject: |
|
|
Ahh good catch mouse. But what's the point?
O=117=aag=K=Lysine?
12 o's?
cheeri-o's ???
naught.
I still think it sucks. |
|
Back to top |
|
|
ignatzmouse Enthusiastic Fan
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Wed Mar 28, 2007 1:43 pm Post subject: |
|
|
Clock? _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
|
deagol Thor's Hammer
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Mar 28, 2007 5:08 pm Post subject: |
|
|
Well, I'm pretty much done with this for now. Here's the latest message I sent to Trav:
Quote: | To: TravelerJ19 [videos (9) | favorites (0) | friends (0)]
Sent: March 28, 2007
Read: —
Subject: Re: Re: Re: Re: Re: 6 and 12
Message:
Ok, so I've been working with ALL those decoding numbers remapped to the MP3 files track numbers, including the 6 and 12. Track 6 is #7 in the MP3, and track 12 is #3. This gives me the following decoding numbers:
7(-6) 7(+1) 7(-6) 3(-4) 7(-6) 3(-4) 7(-6) 3(-0) 7(-6) 7(-5) 7(-6) 3(-4)
Reapplying it to the aminoacid chain, I get:
CECOCOCoCICO which shifts into WFWKWKWoWDWK
I'm using a lower case 'o' for that StopOchre which I'm not sure I'm doing right. I still don't see anything meaningful, so then I tried reading that as a new amino chain, and ran it through BOTH decoding sets of numbers (just in case).
Using the remapped numbers 7(-6) 7(+1) 7(-6) 3(-4) 7(-6) 3(-4) 7(-6) 3(-0) 7(-6) 7(-5) 7(-6) 3(-4) I get PAPSPSPoPIPS which shifts into JBJOJOJoJDJO.
Using the original numbers 6(-3) 6(+1) 6(-3) 12(-8 ) 6(-3) 12(-8 ) 6(-3) 12(-0) 6(-3) 6(-2) 6(-3) 12(-8 ) I get OLOEOEOoOTOE which shifts into LMLWLWLoLRLW.
I even tried the numbers that got me all O's before (6 and 12 but with MP3 shifts), and OLOEOEOoOTOE shifted into IMIAIAIoIOIA. To be thorough, I thought why not do the last possible combination, 7 and 3 with lyrics shifts. This shifted PAPSPSPoPIPS into MBMKMKMoMGMK.
Sorry, but I'm about to give up on this. I can't even take care of what Walter left you since I'm not in the US. I'm just trying to help some friends. Hopefully they'll be able to pick up from where I left.
TravelerJ19 wrote:
> You're right, that C does look wrong. Something else I gave you doesn't seem to make sense, either.
> Maybe you can fix both of these.
>
> > DeagolTheStoor wrote:
> >
> > Ah well alright... although it would fit the way that Walter talks about you if he were your father, haha.
> >
> > So, what's out of place is that C, which came from that "stop" codon, which I interpreted as Ochre (Walter
> > used it in a previous message). I had to pick the 12th letter in OchreOchreOchre (from your Looperama
> > hint). So, how do I fix it? Should I make it an O? and if so, what then? I get all O's, so? That still leads me
> > nowhere. |
|
|
Back to top |
|
|
ignatzmouse Enthusiastic Fan
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Wed Mar 28, 2007 6:19 pm Post subject: |
|
|
And just in case OOOOOOOOOOOO turns out to be it (you never know, stranger things have happened...) I sent:
ignatzmouse15 wrote: | Hi Traveler,
Deagol appears to be taking a little R&R right now, so I thought I'd fill you in on our current progress.
Using the shifts:
6(-6) 6(+1) 6(-6) 12(-4) 6(-6) 12(-4) 6(-6) 12(-0) 6(-6) 6(-5) 6(-6) 12(-4)
and applying them to the amino acids:
Isoleucine
Proline
Isoleucine
IsoleucineIsoleucine
Isoleucine
IsoleucineIsoleucine
Isoleucine
StopOchreStopOchre
Isoleucine
AsparticAcid
Isoleucine
IsoleucineIsoleucine
gets us:
OOOOOOOOOOOO
Very Scooby Doo. If this is a clue for a word, I'd guess "(12 O) Clock". Better would be a Jeapordy question "What time is it?"
Is this
a) Bingo!
b) Nearly there.
c) I wouldn't start from here if I were you.
Please pass on my regards to Walter.
Pip pip,
I.M. | I'm expecting to get the answer (b). Note the sneaky Tachy reference, looking to see if TJ19 is au fait with the Plucky Underdog Resistance. Oh, and the gratiutious Ealing Comedy sign-off for good measure.
ETA: TJ19 has read his YouTube mail. _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
|
ignatzmouse Enthusiastic Fan
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Wed Mar 28, 2007 7:21 pm Post subject: |
|
|
And a very prompt reply:
TravelerJ19 wrote: | I'm not as good as Walter at numbers, but when I count 12 into Ochre, I get "C." I'd say that's also a good answer to your question. A better question would be, "Why isn't the last 'O' with his friends, and who did he get to replace him?" You have all you need in the letters you've decoded and the numbers you used to get there.
ignatzmouse15 wrote:
> Hi Traveler,
>
> Deagol appears to be taking a little R&R right now, so I thought I'd f... |
So the OOOOOOOCOOOO is deliberate, and it's Ochre, not StopOchre (OK, that was a bit of a straw-clutch). O to C is a -12 shift, hmm another 12. _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
|
ShardinsKitten Devoted Fan
Joined: 28 Jan 2007 Posts: 934
|
Posted: Wed Mar 28, 2007 7:54 pm Post subject: |
|
|
how about coo coo? (did I even spell that right?) I'm completely stumped with this one. I mean what are we supposed to do with a bunch of o's and 1 c. poor lonely c. That's wasn't very nice of him.
Quote: | Why isn't the last 'O' with his friends, and who did he get to replace him? |
Could this maybe be a movie or book reference or something? like could we get the answer from a movie or book? (ok maybe that is a stretch but I guess you never know).
There's got to be a clue in that question though... I just can't figure it out. |
|
Back to top |
|
|
deagol Thor's Hammer
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Mar 28, 2007 8:02 pm Post subject: |
|
|
He also told me all the decoding numbers are right the way we have them. So I'm guessing the only thing left to try is the DNA.
I found that the only way to get an O from the 12th character is in Tyrosine (Y), which can come from TAC or TAT codons. The original Ochre was TAA.
So, change that A for a C or a T... ACT? the original DNA would become ATTCCTATCATTATAATCATATACATTGATATCATA or ATTCCTATCATTATAATCATATATATTGATATCATA.
And I'm stuck again. Oh and thanks mouse, for taking over so efficiently. |
|
Back to top |
|
|
ignatzmouse Enthusiastic Fan
Joined: 26 Feb 2007 Posts: 305 Location: Coconino County, AZ
|
Posted: Wed Mar 28, 2007 8:50 pm Post subject: |
|
|
deagol wrote: | He also told me all the decoding numbers are right the way we have them. So I'm guessing the only thing left to try is the DNA.
I found that the only way to get an O from the 12th character is in Tyrosine (Y), which can come from TAC or TAT codons. The original Ochre was TAA.
So, change that A for a C or a T... ACT? the original DNA would become ATTCCTATCATTATAATCATATACATTGATATCATA or ATTCCTATCATTATAATCATATATATTGATATCATA.
And I'm stuck again. Oh and thanks mouse, for taking over so efficiently. |
That was a short vacation
You can also get O by replacing 12(0) by 6(0). Not that this helps, as doing this across the board just produces gibberish Os and Qs.
You can get O by replacing 12(0) by 12(12), so adding the first part of the index to the second gives:
Code: | 6(0) 6(7) 6(0) 12(8) 6(0) 12(8) 6(0) 12(12) 6(0) 6(1) 6(0) 12(8) |
with result:
which (subbing the C back for the O) is:
which is RNA. Applying:
Code: | 12(-4) 12(-4) 12(-0) 12(-4) |
gets, oh what a surprise, gibberish:
OK, time to call it a night...
-- Efficiency Mouse _________________ Facility J: Will the last disgruntled employee to leave please destroy The Cure? |
|
Back to top |
|
|
deagol Thor's Hammer
Joined: 28 Oct 2006 Posts: 1068 Location: No, not here.
|
Posted: Wed Mar 28, 2007 9:04 pm Post subject: |
|
|
ignatzmouse wrote: |
You can get O by replacing 12(0) by 12(12), so adding the first part of the index to the second gives:
Code: | 6(0) 6(7) 6(0) 12(8) 6(0) 12(8) 6(0) 12(12) 6(0) 6(1) 6(0) 12(8) |
|
You lost me on that one. What parts are you adding together?
Edit: oh ok I see what you did now, although I don't see why you did it. Is it just to get 12(12)? |
|
Back to top |
|
|
|
|
You cannot post new topics in this forum You cannot reply to topics in this forum You cannot edit your posts in this forum You cannot delete your posts in this forum You cannot vote in polls in this forum
|
Powered by phpBB © 2001, 2005 phpBB Group
|